Regulon of ModE in Acidovorax sp. JS42

Properties
Regulator type:	Transcription factor
TF locus tag:	Ajs_3123
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -13 Score: 7.3 Sequence: CGCTATTCCATTGATGAATAGCG Locus tag: Ajs_3123 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	Ajs_3123	modE	Molybdate-responsive transcriptional regulator ModE
Position: -34 Score: 7 Sequence: CGCTATTCATCAATGGAATAGCG Locus tag: Ajs_3124 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Ajs_3125 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Ajs_3126 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	Ajs_3124	modA	Molybdate ABC transporter, substrate-binding protein
	Ajs_3125	modB	Molybdate ABC transporter, permease protein
	Ajs_3126	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD