Regulon of ModE in Rhodoferax ferrireducens DSM 15236

Properties
Regulator type:	Transcription factor
TF locus tag:	Rfer_2857
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 6.5 Sequence: CGCTATTCCTAATTAGAATAGCG Locus tag: Rfer_2858 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Rfer_2859 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Rfer_2860 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	Rfer_2858	modA	Molybdate ABC transporter, substrate-binding protein
	Rfer_2859	modB	Molybdate ABC transporter, permease protein
	Rfer_2860	modC	Molybdate ABC transporter, ATP-binding protein
Position: -74 Score: 6.9 Sequence: CGCTATTCTAATTAGGAATAGCG Locus tag: Rfer_2857 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	Rfer_2857	modE	Molybdate-responsive transcriptional regulator ModE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD