Regulog ModE - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pseudomonadaceae
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Pseudomonas aeruginosa PAO1	3	1
Pseudomonas entomophila L48	3	1
Pseudomonas putida KT2440	3	1
Pseudomonas syringae pv. tomato str. DC3000	3	1
Pseudomonas fluorescens Pf-5	3	1
Pseudomonas mendocina ymp	3	1
Pseudomonas stutzeri A1501	4	1
Azotobacter vinelandii AvOP	4	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
modE	Pseudomonas aeruginosa PAO1 Gene: PA0487: Molybdate-responsive transcriptional regulator ModE	Pseudomonas entomophila L48 Gene: PSEEN5123: Molybdate-responsive transcriptional regulator ModE	Pseudomonas putida KT2440 Gene: PP0360: Molybdate-responsive transcriptional regulator ModE	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0492: Molybdate-responsive transcriptional regulator ModE	Pseudomonas fluorescens Pf-5 Gene: PFL_5695: Molybdate-responsive transcriptional regulator ModE	Pseudomonas mendocina ymp Gene: Pmen_4091: Molybdate-responsive transcriptional regulator ModE	* Pseudomonas stutzeri A1501 Site: position = -168 score = 6.53993 sequence = CGCTATATACAAAACGATATAGCG Gene: PST_1348: Molybdate-responsive transcriptional regulator ModE	* Azotobacter vinelandii AvOP Site: position = -46 score = 4.74027 sequence = CTTTATATAAAACTGGATAAATAG Site: position = -164 score = 4.76064 sequence = CGCTATATCATTTGCACTATAAAT Gene: Avin_50680: Molybdate-responsive transcriptional regulator ModE	Molybdate-responsive transcriptional regulator ModE
modA	* Pseudomonas aeruginosa PAO1 Site: position = -84 score = 5.80515 sequence = CGCTATATTCCAAAAGCCATAGCG Gene: PA1863: Molybdate ABC transporter, substrate-binding protein	* Pseudomonas entomophila L48 Site: position = -55 score = 6.20263 sequence = CGCTATATATTCCACGACATAACG Gene: PSEEN2286: Molybdate ABC transporter, substrate-binding protein	* Pseudomonas putida KT2440 Site: position = -46 score = 6.30689 sequence = CGCTATATAGTTAAGGCTATAACG Gene: PP3828: Molybdate ABC transporter, substrate-binding protein	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -128 score = 6.90059 sequence = CGCTATATATTTAAATATATAGCG Gene: PSPTO2973: Molybdate ABC transporter, substrate-binding protein	* Pseudomonas fluorescens Pf-5 Site: position = -101 score = 6.42118 sequence = CGCTATATATTCCGCTATATAGCG Gene: PFL_3412: Molybdate ABC transporter, substrate-binding protein	* Pseudomonas mendocina ymp Site: position = -74 score = 6.01608 sequence = CGCTATATACAAGAAAACATAACG Gene: Pmen_4339: Molybdate ABC transporter, substrate-binding protein	Pseudomonas stutzeri A1501 Gene: PST_1347: Molybdate ABC transporter, substrate-binding protein	2 Azotobacter vinelandii AvOP Gene: Avin_50670: Molybdate ABC transporter, substrate-binding protein Gene: Avin_01300: Molybdate ABC transporter, substrate-binding protein	Molybdate ABC transporter, substrate-binding protein
modB	Pseudomonas aeruginosa PAO1 Gene: PA1862: Molybdate ABC transporter, permease protein	Pseudomonas entomophila L48 Gene: PSEEN2285: Molybdate ABC transporter, permease protein	Pseudomonas putida KT2440 Gene: PP3829: Molybdate ABC transporter, permease protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2974: Molybdate ABC transporter, permease protein	Pseudomonas fluorescens Pf-5 Gene: PFL_3413: Molybdate ABC transporter, permease protein	Pseudomonas mendocina ymp Gene: Pmen_4340: Molybdate ABC transporter, permease protein	Pseudomonas stutzeri A1501 Gene: PST_1346: Molybdate ABC transporter, permease protein	2 Azotobacter vinelandii AvOP Gene: Avin_50660: Molybdate ABC transporter, permease protein Gene: Avin_01290: Molybdate ABC transporter, permease protein	Molybdate ABC transporter, permease protein
modC	Pseudomonas aeruginosa PAO1 Gene: PA1861: Molybdate ABC transporter, ATP-binding protein	Pseudomonas entomophila L48 Gene: PSEEN2284: Molybdate ABC transporter, ATP-binding protein	Pseudomonas putida KT2440 Gene: PP3830: Molybdate ABC transporter, ATP-binding protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2975: Molybdate ABC transporter, ATP-binding protein	Pseudomonas fluorescens Pf-5 Gene: PFL_3414: Molybdate ABC transporter, ATP-binding protein	Pseudomonas mendocina ymp Gene: Pmen_4341: Molybdate ABC transporter, ATP-binding protein	Pseudomonas stutzeri A1501 Gene: PST_1345: Molybdate ABC transporter, ATP-binding protein	3 Azotobacter vinelandii AvOP Gene: Avin_50650: Molybdate ABC transporter, ATP-binding protein Gene: Avin_01580: Molybdate ABC transporter, ATP-binding protein Gene: Avin_01280: Molybdate ABC transporter, ATP-binding protein	Molybdate ABC transporter, ATP-binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ModE - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --