Regulog ModE - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Pseudomonadaceae
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | 3 | 1 |
| Pseudomonas entomophila L48 | 3 | 1 |
| Pseudomonas putida KT2440 | 3 | 1 |
| Pseudomonas syringae pv. tomato str. DC3000 | 3 | 1 |
| Pseudomonas fluorescens Pf-5 | 3 | 1 |
| Pseudomonas mendocina ymp | 3 | 1 |
| Pseudomonas stutzeri A1501 | 4 | 1 |
| Azotobacter vinelandii AvOP | 4 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| modE |
Gene: PA0487: Molybdate-responsive transcriptional regulator ModE |
Gene: PSEEN5123: Molybdate-responsive transcriptional regulator ModE |
Gene: PP0360: Molybdate-responsive transcriptional regulator ModE |
Gene: PSPTO0492: Molybdate-responsive transcriptional regulator ModE |
Gene: PFL_5695: Molybdate-responsive transcriptional regulator ModE |
Gene: Pmen_4091: Molybdate-responsive transcriptional regulator ModE |
*
Pseudomonas stutzeri A1501 Site: position = -168 score = 6.53993 sequence = CGCTATATACAAAACGATATAGCG Gene: PST_1348: Molybdate-responsive transcriptional regulator ModE |
*
Azotobacter vinelandii AvOP Site: position = -46 score = 4.74027 sequence = CTTTATATAAAACTGGATAAATAG Site: position = -164 score = 4.76064 sequence = CGCTATATCATTTGCACTATAAAT Gene: Avin_50680: Molybdate-responsive transcriptional regulator ModE |
Molybdate-responsive transcriptional regulator ModE |
| modA |
*
Pseudomonas aeruginosa PAO1 Site: position = -84 score = 5.80515 sequence = CGCTATATTCCAAAAGCCATAGCG Gene: PA1863: Molybdate ABC transporter, substrate-binding protein |
*
Pseudomonas entomophila L48 Site: position = -55 score = 6.20263 sequence = CGCTATATATTCCACGACATAACG Gene: PSEEN2286: Molybdate ABC transporter, substrate-binding protein |
*
Pseudomonas putida KT2440 Site: position = -46 score = 6.30689 sequence = CGCTATATAGTTAAGGCTATAACG Gene: PP3828: Molybdate ABC transporter, substrate-binding protein |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -128 score = 6.90059 sequence = CGCTATATATTTAAATATATAGCG Gene: PSPTO2973: Molybdate ABC transporter, substrate-binding protein |
*
Pseudomonas fluorescens Pf-5 Site: position = -101 score = 6.42118 sequence = CGCTATATATTCCGCTATATAGCG Gene: PFL_3412: Molybdate ABC transporter, substrate-binding protein |
*
Pseudomonas mendocina ymp Site: position = -74 score = 6.01608 sequence = CGCTATATACAAGAAAACATAACG Gene: Pmen_4339: Molybdate ABC transporter, substrate-binding protein |
Gene: PST_1347: Molybdate ABC transporter, substrate-binding protein |
2
Azotobacter vinelandii AvOP Gene: Avin_50670: Molybdate ABC transporter, substrate-binding protein Gene: Avin_01300: Molybdate ABC transporter, substrate-binding protein |
Molybdate ABC transporter, substrate-binding protein |
| modB |
Gene: PA1862: Molybdate ABC transporter, permease protein |
Gene: PSEEN2285: Molybdate ABC transporter, permease protein |
Gene: PP3829: Molybdate ABC transporter, permease protein |
Gene: PSPTO2974: Molybdate ABC transporter, permease protein |
Gene: PFL_3413: Molybdate ABC transporter, permease protein |
Gene: Pmen_4340: Molybdate ABC transporter, permease protein |
Gene: PST_1346: Molybdate ABC transporter, permease protein |
2
Azotobacter vinelandii AvOP Gene: Avin_50660: Molybdate ABC transporter, permease protein Gene: Avin_01290: Molybdate ABC transporter, permease protein |
Molybdate ABC transporter, permease protein |
| modC |
Gene: PA1861: Molybdate ABC transporter, ATP-binding protein |
Gene: PSEEN2284: Molybdate ABC transporter, ATP-binding protein |
Gene: PP3830: Molybdate ABC transporter, ATP-binding protein |
Gene: PSPTO2975: Molybdate ABC transporter, ATP-binding protein |
Gene: PFL_3414: Molybdate ABC transporter, ATP-binding protein |
Gene: Pmen_4341: Molybdate ABC transporter, ATP-binding protein |
Gene: PST_1345: Molybdate ABC transporter, ATP-binding protein |
3
Azotobacter vinelandii AvOP Gene: Avin_50650: Molybdate ABC transporter, ATP-binding protein Gene: Avin_01580: Molybdate ABC transporter, ATP-binding protein Gene: Avin_01280: Molybdate ABC transporter, ATP-binding protein |
Molybdate ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |