Regulon of ModE in Pseudomonas stutzeri A1501

Properties
Regulator type:	Transcription factor
TF locus tag:	PST_1348
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Pseudomonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pseudomonadaceae
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -168 Score: 6.5 Sequence: CGCTATATACAAAACGATATAGCG Locus tag: PST_1348 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE Locus tag: PST_1347 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: PST_1346 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: PST_1345 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	PST_1348	modE	Molybdate-responsive transcriptional regulator ModE
	PST_1347	modA	Molybdate ABC transporter, substrate-binding protein
	PST_1346	modB	Molybdate ABC transporter, permease protein
	PST_1345	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD