Regulon of ModE in Pseudomonas mendocina ymp

Properties
Regulator type:	Transcription factor
TF locus tag:	Pmen_4091
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pseudomonadaceae
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 6 Sequence: CGCTATATACAAGAAAACATAACG Locus tag: Pmen_4339 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Pmen_4340 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Pmen_4341 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	Pmen_4339	modA	Molybdate ABC transporter, substrate-binding protein
	Pmen_4340	modB	Molybdate ABC transporter, permease protein
	Pmen_4341	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD