Regulon of ModE in Azotobacter vinelandii AvOP

Properties
Regulator type:	Transcription factor
TF locus tag:	Avin_50680
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Pseudomonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Pseudomonadaceae
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -164 Score: 4.8 Sequence: CGCTATATCATTTGCACTATAAAT Position: -46 Score: 4.7 Sequence: CTTTATATAAAACTGGATAAATAG Locus tag: Avin_50680 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE Locus tag: Avin_50670 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Avin_50660 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Avin_50650 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	Avin_50680	modE	Molybdate-responsive transcriptional regulator ModE
	Avin_50670	modA	Molybdate ABC transporter, substrate-binding protein
	Avin_50660	modB	Molybdate ABC transporter, permease protein
	Avin_50650	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD