Regulog RbsR - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - RbsR
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 6 | 1 |
| Acidovorax sp. JS42 | ||
| Comamonas testosteroni KF-1 | ||
| Delftia acidovorans SPH-1 | ||
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | ||
| Rhodoferax ferrireducens DSM 15236 | ||
| Variovorax paradoxus S110 | 6 | 1 |
| Verminephrobacter eiseniae EF01-2 | ||
| Methylibium petroleiphilum PM1 | ||
| Leptothrix cholodnii SP-6 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| rbsB |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -124 score = 6.80178 sequence = AAGCGCAAACGTTTGCGCAA Gene: Aave_4196: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
|
|
|
|
|
*
Variovorax paradoxus S110 Site: position = -95 score = 6.62679 sequence = ATTAGCAAACGTTTGCGCAA Gene: Vapar_4636: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: Veis_2133: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
|
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| rbsA |
Gene: Aave_4197: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
|
|
|
|
|
Gene: Vapar_4637: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: Veis_2132: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
|
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
Gene: Aave_4198: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
|
|
|
|
|
Gene: Vapar_4638: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: Veis_2131: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
|
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsR |
Gene: Aave_4199: Transcriptional repressor of ribose utilization, LacI family |
|
|
|
|
|
|
Gene: Vapar_4639: Transcriptional repressor of ribose utilization, LacI family |
|
|
|
Transcriptional repressor of ribose utilization, LacI family |
| rbsK |
Gene: Aave_4200: Ribokinase (EC 2.7.1.15) |
|
|
|
|
|
|
Gene: Vapar_4640: Ribokinase (EC 2.7.1.15) |
Gene: Veis_2130: Ribokinase (EC 2.7.1.15) |
|
|
Ribokinase (EC 2.7.1.15) |
| rbsD |
Gene: Aave_4201: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
|
|
|
|
|
Gene: Vapar_4641: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
|
|
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |