Regulog TrpR - Psychromonadaceae/Aeromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3	2	1
Moritella sp. PE36	2	1
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Aeromonas salmonicida subsp. salmonicida A449
Tolumonas auensis DSM 9187

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
trpR	Psychromonas ingrahamii 37	* Psychromonas sp. CNPT3 Site: position = -51 score = 5.49511 sequence = TGTACTGCTGTACTGTTACG Gene: PCNPT3_05849: Trp operon repressor	* Moritella sp. PE36 Site: position = 3 score = 6.21122 sequence = TGTAATGCTGTACTATTACG Gene: PE36_21864: Trp operon repressor	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Trp operon repressor
mtr	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3 Gene: PCNPT3_05844: Tryptophan-specific transport protein	Moritella sp. PE36 Gene: PE36_21859: Tryptophan-specific transport protein	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	Tryptophan-specific transport protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --