Regulog TrpR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - TrpR
- By TF family - TrpR
- By effector - Tryptophan
- By pathway - Tryptophan biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 | 2 | 1 |
| Moritella sp. PE36 | 2 | 1 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||
| Aeromonas salmonicida subsp. salmonicida A449 | ||
| Tolumonas auensis DSM 9187 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| trpR |
|
*
Psychromonas sp. CNPT3 Site: position = -51 score = 5.49511 sequence = TGTACTGCTGTACTGTTACG Gene: PCNPT3_05849: Trp operon repressor |
*
Moritella sp. PE36 Site: position = 3 score = 6.21122 sequence = TGTAATGCTGTACTATTACG Gene: PE36_21864: Trp operon repressor |
|
|
|
Trp operon repressor |
| mtr |
|
Gene: PCNPT3_05844: Tryptophan-specific transport protein |
Gene: PE36_21859: Tryptophan-specific transport protein |
|
|
|
Tryptophan-specific transport protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |