Profile of regulator TrpR in Psychromonadaceae/Aeromonadales
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Regulog: | TrpR - Psychromonadaceae/Aeromonadales |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - TrpR
- By TF family - TrpR
- By effector - Tryptophan
- By pathway - Tryptophan biosynthesis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Psychromonas sp. CNPT3 | |||||
| PCNPT3_05849 | trpR | -51 | 5.5 | TGTACTGCTGTACTGTTACG | |
| Moritella sp. PE36 | |||||
| PE36_21864 | trpR | 3 | 6.2 | TGTAATGCTGTACTATTACG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |