Regulon of TrpR in Psychromonas sp. CNPT3

Properties
Regulator type:	Transcription factor
TF locus tag:	PCNPT3_05849
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Regulog:	TrpR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - TrpR
By TF family - TrpR
By effector - Tryptophan
By pathway - Tryptophan biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 5.5 Sequence: TGTACTGCTGTACTGTTACG Locus tag: PCNPT3_05849 Name: trpR Funciton: Trp operon repressor Locus tag: PCNPT3_05844 Name: mtr Funciton: Tryptophan-specific transport protein
	PCNPT3_05849	trpR	Trp operon repressor
	PCNPT3_05844	mtr	Tryptophan-specific transport protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD