Orthologous regulated operons containing trpR gene

Properties
Regulog:	TrpR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Phylum:	Proteobacteria/gamma

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: 3 Score: 6.21122 Sequence: TGTAATGCTGTACTATTACG Locus tag: PE36_21864 Name: trpR Funciton: Trp operon repressor Locus tag: PE36_21859 Name: mtr Funciton: Tryptophan-specific transport protein
trpR-mtr	3	6.2	TGTAATGCTGTACTATTACG	PE36_21864
Psychromonas sp. CNPT3
Position: -51 Score: 5.49511 Sequence: TGTACTGCTGTACTGTTACG Locus tag: PCNPT3_05849 Name: trpR Funciton: Trp operon repressor Locus tag: PCNPT3_05844 Name: mtr Funciton: Tryptophan-specific transport protein
trpR-mtr	-51	5.5	TGTACTGCTGTACTGTTACG	PCNPT3_05849

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --