Regulog Fur - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Xylella fastidiosa 9a5c	10	5
Xanthomonas axonopodis pv. citri str. 306	19	11
Xanthomonas campestris pv. campestris str. ATCC 33913	20	11
Stenotrophomonas maltophilia K279a	39	17

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
bfd	* Xylella fastidiosa 9a5c Site: position = -64 score = 5.36465 sequence = AATTGACATTCATTCTCATCT Gene: XF0394: Bacterioferritin-associated ferredoxin	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -73 score = 5.04459 sequence = AATTGACACCTATTCTCGTTT Gene: XAC0492: Bacterioferritin-associated ferredoxin	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -73 score = 5.04459 sequence = AATTGACACCTATTCTCGTTT Gene: XCC0481: Bacterioferritin-associated ferredoxin	* Stenotrophomonas maltophilia K279a Site: position = -73 score = 5.38699 sequence = GATTGACAACCATTCTCGTTT Gene: Smlt4298: Bacterioferritin-associated ferredoxin	Bacterioferritin-associated ferredoxin
bfr	* Xylella fastidiosa 9a5c Site: position = -78 score = 4.88222 sequence = TAATGAGCACGATTTTCGTTC Gene: XF0395: Bacterioferritin	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -80 score = 4.35493 sequence = AACTGATCACGATTCGCGTTC Gene: XAC0493: Bacterioferritin	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -80 score = 4.35493 sequence = AACTGATCACGATTCGCGTTC Gene: XCC0482: Bacterioferritin	* Stenotrophomonas maltophilia K279a Site: position = -81 score = 4.24574 sequence = CAATGCGCACGATTCGCGTTC Gene: Smlt4297: Bacterioferritin	Bacterioferritin

CRON 2.
fhuA	* Xylella fastidiosa 9a5c Site: position = -112 score = 5.62784 sequence = TATTGAAAATCATTCTCCTTT Gene: XF0599: Ferrichrome-iron receptor, TonB-dependent	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -252 score = 5.46553 sequence = AAAGAAGAATGATTTGCATTT Gene: XAC2941: Ferrichrome-iron receptor, TonB-dependent	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -263 score = 5.46553 sequence = AAAGAAGAATGATTTGCATTT Gene: XCC2772: Ferrichrome-iron receptor, TonB-dependent	Stenotrophomonas maltophilia K279a Gene: Smlt1148: Ferrichrome-iron receptor, TonB-dependent	Ferrichrome-iron receptor, TonB-dependent
piuC	Xylella fastidiosa 9a5c Gene: XF0598: Iron-uptake factor PiuC	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2942: Iron-uptake factor PiuC	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2773: Iron-uptake factor PiuC	Stenotrophomonas maltophilia K279a Gene: Smlt1146: Iron-uptake factor PiuC	Iron-uptake factor PiuC
XAC2943	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2943: FOG: TPR repeat, SEL1 subfamily	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2774: FOG: TPR repeat, SEL1 subfamily	Stenotrophomonas maltophilia K279a Gene: Smlt1147: FOG: TPR repeat, SEL1 subfamily	FOG: TPR repeat, SEL1 subfamily
pepSY	Xylella fastidiosa 9a5c Gene: XF0597: putative transmembrane PepSY family protein	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2944: putative transmembrane PepSY family protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2775: putative transmembrane PepSY family protein	* Stenotrophomonas maltophilia K279a Site: position = -85 score = 4.59134 sequence = AATTGCGAGCTATTCTCATCA Gene: Smlt1142: putative transmembrane PepSY family protein	putative transmembrane PepSY family protein
COG3656	Xylella fastidiosa 9a5c Gene: XF0596: Predicted periplasmic protein	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2945: Predicted periplasmic protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2776: Predicted periplasmic protein	Stenotrophomonas maltophilia K279a Gene: Smlt1141: Predicted periplasmic protein	Predicted periplasmic protein
Smlt1149	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -66 score = 5.07384 sequence = ATATGCGAATCATTATCGTTG Gene: Smlt1149: hypothetical protein	hypothetical protein

CRON 3.
hemP	Xylella fastidiosa 9a5c	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -2 score = 6.14308 sequence = AAATGAGAATGGTTATTATTT Site: position = -26 score = 4.88495 sequence = AAATGAGAATGGCTCTTGATC Gene: XAC0822: Hemin uptake protein HemP	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -2 score = 6.14308 sequence = AAATGAGAATGGTTATTATTT Site: position = -26 score = 4.88495 sequence = AAATGAGAATGGCTCTTGATC Gene: XCC0767: Hemin uptake protein HemP	* Stenotrophomonas maltophilia K279a Site: position = -45 score = 6.12706 sequence = AACTGAGAATCATTATCATTT Site: position = -69 score = 5.13479 sequence = AATTGAGAATGGTTGTTGATT Gene: Smlt0794: Hemin uptake protein HemP	Hemin uptake protein HemP
hemR	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC0823: Hemin uptake system outer membrane receptor, TonB-dependent	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC0768: Hemin uptake system outer membrane receptor, TonB-dependent	Stenotrophomonas maltophilia K279a Gene: Smlt0795: Hemin uptake system outer membrane receptor, TonB-dependent	Hemin uptake system outer membrane receptor, TonB-dependent
XAC0824	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC0824: Hemin transport protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC0769: Hemin transport protein	Stenotrophomonas maltophilia K279a Gene: Smlt0796: Hemin transport protein	Hemin transport protein

CRON 4.
fhuA	Xylella fastidiosa 9a5c	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -28 score = 5.23744 sequence = ATTTGATAACCATTCCCATTA Gene: XAC1435: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -28 score = 5.23744 sequence = ATTTGATAACCATTCCCATTA Gene: XCC1391: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent	* Stenotrophomonas maltophilia K279a Site: position = -42 score = 5.86012 sequence = AAATGCTAATCTTTCTCATTT Gene: Smlt3022: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent	Outer membrane receptor proteins, mostly Fe transport, TonB-dependent

CRON 5.
fpr	Xylella fastidiosa 9a5c Gene: XF1889: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -71 score = 5.47226 sequence = AAATGAGAGTTCATCTCATTT Gene: XAC1458: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -73 score = 5.47226 sequence = AAATGAGAGTTCATCTCATTT Gene: XCC1414: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)	* Stenotrophomonas maltophilia K279a Site: position = -61 score = 5.48721 sequence = CAATGAGAACCCATCTCATTT Gene: Smlt3227: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)	Ferredoxin--NADP(+) reductase (EC 1.18.1.2)

CRON 6.
feoA	* Xylella fastidiosa 9a5c Site: position = -34 score = 4.68174 sequence = TATTGAGAACGATTCTTGTCA Gene: XF0932: Ferrous iron transport protein A	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -35 score = 4.63126 sequence = AATTGAGAACCATTCCTAACA Gene: XAC1854: Ferrous iron transport protein A	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -35 score = 4.63126 sequence = AATTGAGAACCATTCCTAACA Gene: XCC1834: Ferrous iron transport protein A	* Stenotrophomonas maltophilia K279a Site: position = -38 score = 4.47351 sequence = AATCGAGAACCATTTACATCC Gene: Smlt2210: Ferrous iron transport protein A	Ferrous iron transport protein A
feoB	Xylella fastidiosa 9a5c Gene: XF0933: Ferrous iron transport protein B	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC1855: Ferrous iron transport protein B	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC1835: Ferrous iron transport protein B	Stenotrophomonas maltophilia K279a Gene: Smlt2211: Ferrous iron transport protein B	Ferrous iron transport protein B
XF0934	Xylella fastidiosa 9a5c Gene: XF0934: conserved hypothetical protein	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC1856: conserved hypothetical protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC1836: conserved hypothetical protein	Stenotrophomonas maltophilia K279a Gene: Smlt2212: conserved hypothetical protein	conserved hypothetical protein

CRON 7.
fhuE	Xylella fastidiosa 9a5c	2 Xanthomonas axonopodis pv. citri str. 306* Site: position = -120 score = 5.95085 sequence = AAATGTGAATCATTCCCATTA Gene: XAC3370: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent Gene: XAC3498: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent	2 Xanthomonas campestris pv. campestris str. ATCC 33913* Site: position = -121 score = 5.95085 sequence = AAATGTGAATCATTCCCATTA Gene: XCC3216: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent Gene: XCC3215: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent	Stenotrophomonas maltophilia K279a	Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent

CRON 8.
fpvA	Xylella fastidiosa 9a5c	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -175 score = 5.56948 sequence = AAACGATAACGATTTACATTT Gene: XAC0176: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -167 score = 5.56948 sequence = AAACGATAACGATTTACATTT Gene: XCC0158: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent	* Stenotrophomonas maltophilia K279a Site: position = -136 score = 4.46017 sequence = TGTTAAGAATTATTTACATTT Gene: Smlt1233: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent	Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent

CRON 9.
pfeA	Xylella fastidiosa 9a5c	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -177 score = 4.90803 sequence = ATTTGAGAATGAATCGCATCT Gene: XAC3620: Outer membrane receptor for ferrienterochelin, TonB-dependent	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -142 score = 4.84844 sequence = ATTTGAGAATCACTCGCATTG Gene: Smlt1426: Outer membrane receptor for ferrienterochelin, TonB-dependent	Outer membrane receptor for ferrienterochelin, TonB-dependent

CRON 10.
fecI	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -28 score = 5.7748 sequence = TAATGGGAATCATTCGCATTA Gene: Smlt2848: Putative RNA polymerase sigma factor for iron metabolism	Putative RNA polymerase sigma factor for iron metabolism
fecR	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2849: Putative transmembrane FecR family iron uptake regulator protein	Putative transmembrane FecR family iron uptake regulator protein
fecA	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2850: putative TonB dependent extracellular heme-binding protein	putative TonB dependent extracellular heme-binding protein

CRON 11.
XAC0271	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC0271: Putative iron uptake protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC0252: Putative iron uptake protein	* Stenotrophomonas maltophilia K279a Site: position = -126 score = 5.59226 sequence = AAATGCGAATGCCTATCATTT Gene: Smlt1567: Putative iron uptake protein	Putative iron uptake protein
pepSY	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC0270: putative transmembrane PepSY domain protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC0251: putative transmembrane PepSY domain protein	Stenotrophomonas maltophilia K279a Gene: Smlt1566: putative transmembrane PepSY domain protein	putative transmembrane PepSY domain protein
XAC0269	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC0269: Putative iron uptake protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC0250: Putative iron uptake protein	Stenotrophomonas maltophilia K279a Gene: Smlt1565: Putative iron uptake protein	Putative iron uptake protein

CRON 12.
fecI2	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -86 score = 5.38769 sequence = AAACGCGAACGGTTCCCATTA Gene: Smlt2664: putative RNA polymerase sigma factor for iron metabolism	putative RNA polymerase sigma factor for iron metabolism
fecR2	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2665: putative iron uptake transcriptional regulator protein	putative iron uptake transcriptional regulator protein
fecA2	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2666: putative TonB-dependent ferric siderophore receptor	putative TonB-dependent ferric siderophore receptor

CRON 13.
Smlt1145	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -99 score = 5.27106 sequence = TTTTGGCAATCATTCTCATTT Site: position = -76 score = 4.13244 sequence = AACGGCTAACAGCTCTCATTA Gene: Smlt1145: putative transmembrane protein	putative transmembrane protein
bfrA	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt1144c: putative exogenous ferric siderophore receptor, TonB-dependent	putative exogenous ferric siderophore receptor, TonB-dependent

CRON 14.
fpvA	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -72 score = 5.18391 sequence = TAATAATATTCATTCTCACTT Gene: XCC3518: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent	Stenotrophomonas maltophilia K279a	Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent

CRON 15.
COG1272	* Xylella fastidiosa 9a5c Site: position = -37 score = 5.10574 sequence = AAATGCGAATTATTCGCGGTT Gene: XF0175: Predicted membrane protein hemolysin III homolog	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -37 score = 4.26428 sequence = CGATGCGAATCGCTCGCAATT Gene: XAC3043: Predicted membrane protein hemolysin III homolog	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2860: Predicted membrane protein hemolysin III homolog	Stenotrophomonas maltophilia K279a Gene: Smlt3638: Predicted membrane protein hemolysin III homolog	Predicted membrane protein hemolysin III homolog

CRON 16.
fecI3	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -69 score = 5.05638 sequence = GAACGTGACTGATTCTCATTA Gene: Smlt3900: putative RNA polymerase ECF sigma factor for iron metabolism	putative RNA polymerase ECF sigma factor for iron metabolism
fecR3	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt3899: putative transmembrane FecR sensor protein	putative transmembrane FecR sensor protein
fecA3	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt3898: putative extracellular heme-binding protein, TonB-dependent	putative extracellular heme-binding protein, TonB-dependent

CRON 17.
COG4771	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = 4 score = 4.99324 sequence = AATCAGCAATAATTCTCATTT Gene: Smlt2858: Outer membrane receptor for ferrienterochelin, TonB-dependent	Outer membrane receptor for ferrienterochelin, TonB-dependent

CRON 18.
fhuE	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -94 score = 4.81624 sequence = AAATAGGAATAGTTCGTATTA Gene: Smlt3999: Putative TonB-dependent receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent	Putative TonB-dependent receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent

CRON 19.
fecI4	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -87 score = 4.61891 sequence = GGATGCAAATGATTCTCTTTT Gene: Smlt2935: putative ECF-family sigma factor for iron metabolism	putative ECF-family sigma factor for iron metabolism
fecR4	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2936: putative transcriptional regulatory FecR iron transport regulator family protein	putative transcriptional regulatory FecR iron transport regulator family protein
fecA4	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2937: putative TonB dependent receptor protein	putative TonB dependent receptor protein
Smlt2938	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2938: putative iron regulated lipoprotein	putative iron regulated lipoprotein
Smlt2939	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2939: putative TonB-like protein	putative TonB-like protein

CRON 20.
COG4773	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -31 score = 4.61897 sequence = GGATAAGAATCGTTATCATTG Gene: XCC4162: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent	Stenotrophomonas maltophilia K279a	Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Fur - Xanthomonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --