Regulon of Fur in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type:	Transcription factor
TF locus tag:	XAC1517
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Xanthomonadales
Statistics of regulated genes:
- Genes	19
- Operons	11
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 4.9 Sequence: ATTTGAGAATGAATCGCATCT Locus tag: XAC3620 Name: pfeA Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
	XAC3620	pfeA	Outer membrane receptor for ferrienterochelin, TonB-dependent
Position: -175 Score: 5.6 Sequence: AAACGATAACGATTTACATTT Locus tag: XAC0176 Name: fpvA Funciton: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
	XAC0176	fpvA	Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
Position: -28 Score: 5.2 Sequence: ATTTGATAACCATTCCCATTA Locus tag: XAC1435 Name: fhuA Funciton: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
	XAC1435	fhuA	Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
Position: -71 Score: 5.5 Sequence: AAATGAGAGTTCATCTCATTT Locus tag: XAC1458 Name: fpr Funciton: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
	XAC1458	fpr	Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
Position: -120 Score: 6 Sequence: AAATGTGAATCATTCCCATTA Locus tag: XAC3370 Name: fhuE Funciton: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
	XAC3370	fhuE	Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
Position: -26 Score: 4.9 Sequence: AAATGAGAATGGCTCTTGATC Position: -2 Score: 6.1 Sequence: AAATGAGAATGGTTATTATTT Locus tag: XAC0822 Name: hemP Funciton: Hemin uptake protein HemP Locus tag: XAC0823 Name: hemR Funciton: Hemin uptake system outer membrane receptor, TonB-dependent Locus tag: XAC0824 Name: XAC0824 Funciton: Hemin transport protein
	XAC0822	hemP	Hemin uptake protein HemP
	XAC0823	hemR	Hemin uptake system outer membrane receptor, TonB-dependent
	XAC0824	XAC0824	Hemin transport protein
Position: -37 Score: 4.3 Sequence: CGATGCGAATCGCTCGCAATT Locus tag: XAC3043 Name: COG1272 Funciton: Predicted membrane protein hemolysin III homolog
	XAC3043	COG1272	Predicted membrane protein hemolysin III homolog
Position: -252 Score: 5.5 Sequence: AAAGAAGAATGATTTGCATTT Locus tag: XAC2941 Name: fhuA Funciton: Ferrichrome-iron receptor, TonB-dependent Locus tag: XAC2942 Name: piuC Funciton: Iron-uptake factor PiuC Locus tag: XAC2943 Name: XAC2943 Funciton: FOG: TPR repeat, SEL1 subfamily Locus tag: XAC2944 Name: pepSY Funciton: putative transmembrane PepSY family protein Locus tag: XAC2945 Name: COG3656 Funciton: Predicted periplasmic protein
	XAC2941	fhuA	Ferrichrome-iron receptor, TonB-dependent
	XAC2942	piuC	Iron-uptake factor PiuC
	XAC2943	XAC2943	FOG: TPR repeat, SEL1 subfamily
	XAC2944	pepSY	putative transmembrane PepSY family protein
	XAC2945	COG3656	Predicted periplasmic protein
Position: -80 Score: 4.4 Sequence: AACTGATCACGATTCGCGTTC Locus tag: XAC0493 Name: bfr Funciton: Bacterioferritin
	XAC0493	bfr	Bacterioferritin
Position: -73 Score: 5 Sequence: AATTGACACCTATTCTCGTTT Locus tag: XAC0492 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	XAC0492	bfd	Bacterioferritin-associated ferredoxin
Position: -35 Score: 4.6 Sequence: AATTGAGAACCATTCCTAACA Locus tag: XAC1854 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: XAC1855 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: XAC1856 Name: XF0934 Funciton: conserved hypothetical protein
	XAC1854	feoA	Ferrous iron transport protein A
	XAC1855	feoB	Ferrous iron transport protein B
	XAC1856	XF0934	conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Xanthomonas axonopodis pv. citri str. 306

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --