Regulon of Fur in Stenotrophomonas maltophilia K279a

Properties
Regulator type:	Transcription factor
TF locus tag:	Smlt1986
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Xanthomonadales
Statistics of regulated genes:
- Genes	39
- Operons	17
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 4.5 Sequence: TGTTAAGAATTATTTACATTT Locus tag: Smlt1233 Name: fpvA Funciton: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
	Smlt1233	fpvA	Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
Position: -87 Score: 4.6 Sequence: GGATGCAAATGATTCTCTTTT Locus tag: Smlt2935 Name: fecI4 Funciton: putative ECF-family sigma factor for iron metabolism Locus tag: Smlt2936 Name: fecR4 Funciton: putative transcriptional regulatory FecR iron transport regulator family protein Locus tag: Smlt2937 Name: fecA4 Funciton: putative TonB dependent receptor protein Locus tag: Smlt2938 Name: null Funciton: putative iron regulated lipoprotein Locus tag: Smlt2939 Name: null Funciton: putative TonB-like protein
	Smlt2935	fecI4	putative ECF-family sigma factor for iron metabolism
	Smlt2936	fecR4	putative transcriptional regulatory FecR iron transport regulator family protein
	Smlt2937	fecA4	putative TonB dependent receptor protein
	Smlt2938		putative iron regulated lipoprotein
	Smlt2939		putative TonB-like protein
Position: -28 Score: 5.8 Sequence: TAATGGGAATCATTCGCATTA Locus tag: Smlt2848 Name: fecI Funciton: Putative RNA polymerase sigma factor for iron metabolism Locus tag: Smlt2849 Name: fecR Funciton: Putative transmembrane FecR family iron uptake regulator protein Locus tag: Smlt2850 Name: fecA Funciton: putative TonB dependent extracellular heme-binding protein
	Smlt2848	fecI	Putative RNA polymerase sigma factor for iron metabolism
	Smlt2849	fecR	Putative transmembrane FecR family iron uptake regulator protein
	Smlt2850	fecA	putative TonB dependent extracellular heme-binding protein
Position: -61 Score: 5.5 Sequence: CAATGAGAACCCATCTCATTT Locus tag: Smlt3227 Name: fpr Funciton: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
	Smlt3227	fpr	Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
Position: -38 Score: 4.5 Sequence: AATCGAGAACCATTTACATCC Locus tag: Smlt2210 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Smlt2211 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: Smlt2212 Name: XF0934 Funciton: conserved hypothetical protein
	Smlt2210	feoA	Ferrous iron transport protein A
	Smlt2211	feoB	Ferrous iron transport protein B
	Smlt2212	XF0934	conserved hypothetical protein
Position: -94 Score: 4.8 Sequence: AAATAGGAATAGTTCGTATTA Locus tag: Smlt3999 Name: fhuE Funciton: Putative TonB-dependent receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
	Smlt3999	fhuE	Putative TonB-dependent receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
Position: -99 Score: 5.3 Sequence: TTTTGGCAATCATTCTCATTT Position: -76 Score: 4.1 Sequence: AACGGCTAACAGCTCTCATTA Locus tag: Smlt1145 Name: null Funciton: putative transmembrane protein Locus tag: Smlt1144c Name: bfrA Funciton: putative exogenous ferric siderophore receptor, TonB-dependent
	Smlt1145		putative transmembrane protein
	Smlt1144c	bfrA	putative exogenous ferric siderophore receptor, TonB-dependent
Position: -86 Score: 5.4 Sequence: AAACGCGAACGGTTCCCATTA Locus tag: Smlt2664 Name: fecI2 Funciton: putative RNA polymerase sigma factor for iron metabolism Locus tag: Smlt2665 Name: fecR2 Funciton: putative iron uptake transcriptional regulator protein Locus tag: Smlt2666 Name: fecA2 Funciton: putative TonB-dependent ferric siderophore receptor
	Smlt2664	fecI2	putative RNA polymerase sigma factor for iron metabolism
	Smlt2665	fecR2	putative iron uptake transcriptional regulator protein
	Smlt2666	fecA2	putative TonB-dependent ferric siderophore receptor
Position: -69 Score: 5.1 Sequence: AATTGAGAATGGTTGTTGATT Position: -45 Score: 6.1 Sequence: AACTGAGAATCATTATCATTT Locus tag: Smlt0794 Name: hemP Funciton: Hemin uptake protein HemP Locus tag: Smlt0795 Name: hemR Funciton: Hemin uptake system outer membrane receptor, TonB-dependent Locus tag: Smlt0796 Name: XAC0824 Funciton: Hemin transport protein
	Smlt0794	hemP	Hemin uptake protein HemP
	Smlt0795	hemR	Hemin uptake system outer membrane receptor, TonB-dependent
	Smlt0796	XAC0824	Hemin transport protein
Position: -81 Score: 4.2 Sequence: CAATGCGCACGATTCGCGTTC Position: -73 Score: 5.4 Sequence: GATTGACAACCATTCTCGTTT Locus tag: Smlt4298 Name: bfd Funciton: Bacterioferritin-associated ferredoxin Locus tag: Smlt4297 Name: bfr Funciton: Bacterioferritin
	Smlt4298	bfd	Bacterioferritin-associated ferredoxin
	Smlt4297	bfr	Bacterioferritin
Position: -85 Score: 4.6 Sequence: AATTGCGAGCTATTCTCATCA Locus tag: Smlt1142 Name: pepSY Funciton: putative transmembrane PepSY family protein Locus tag: Smlt1141 Name: COG3656 Funciton: Predicted periplasmic protein
	Smlt1142	pepSY	putative transmembrane PepSY family protein
	Smlt1141	COG3656	Predicted periplasmic protein
Position: -66 Score: 5.1 Sequence: ATATGCGAATCATTATCGTTG Locus tag: Smlt1149 Name: null Funciton: hypothetical protein Locus tag: Smlt1148 Name: fhuA Funciton: Ferrichrome-iron receptor, TonB-dependent Locus tag: Smlt1147 Name: XAC2943 Funciton: FOG: TPR repeat, SEL1 subfamily Locus tag: Smlt1146 Name: piuC Funciton: Iron-uptake factor PiuC
	Smlt1149		hypothetical protein
	Smlt1148	fhuA	Ferrichrome-iron receptor, TonB-dependent
	Smlt1147	XAC2943	FOG: TPR repeat, SEL1 subfamily
	Smlt1146	piuC	Iron-uptake factor PiuC
Position: -69 Score: 5.1 Sequence: GAACGTGACTGATTCTCATTA Locus tag: Smlt3900 Name: fecI3 Funciton: putative RNA polymerase ECF sigma factor for iron metabolism Locus tag: Smlt3899 Name: fecR3 Funciton: putative transmembrane FecR sensor protein Locus tag: Smlt3898 Name: fecA3 Funciton: putative extracellular heme-binding protein, TonB-dependent
	Smlt3900	fecI3	putative RNA polymerase ECF sigma factor for iron metabolism
	Smlt3899	fecR3	putative transmembrane FecR sensor protein
	Smlt3898	fecA3	putative extracellular heme-binding protein, TonB-dependent
Position: 4 Score: 5 Sequence: AATCAGCAATAATTCTCATTT Locus tag: Smlt2858 Name: COG4771 Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
	Smlt2858	COG4771	Outer membrane receptor for ferrienterochelin, TonB-dependent
Position: -126 Score: 5.6 Sequence: AAATGCGAATGCCTATCATTT Locus tag: Smlt1567 Name: XAC0271 Funciton: Putative iron uptake protein Locus tag: Smlt1566 Name: pepSY Funciton: putative transmembrane PepSY domain protein Locus tag: Smlt1565 Name: XAC0269 Funciton: Putative iron uptake protein
	Smlt1567	XAC0271	Putative iron uptake protein
	Smlt1566	pepSY	putative transmembrane PepSY domain protein
	Smlt1565	XAC0269	Putative iron uptake protein
Position: -42 Score: 5.9 Sequence: AAATGCTAATCTTTCTCATTT Locus tag: Smlt3022 Name: fhuA Funciton: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
	Smlt3022	fhuA	Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
Position: -142 Score: 4.8 Sequence: ATTTGAGAATCACTCGCATTG Locus tag: Smlt1426 Name: pfeA Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
	Smlt1426	pfeA	Outer membrane receptor for ferrienterochelin, TonB-dependent

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Stenotrophomonas maltophilia K279a

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --