Regulog NagC - Pasteurellales

Properties
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By trascription factor - NagC
By taxonomy - Pasteurellales
By TF family - ROK
By effector - N-acetylglucosamine-6-phosphate
By pathway - N-acetylglucosamine utilization

Statistics of regulated genes
Genome	Genes	Operons
Haemophilus influenzae Rd KW20
Aggregatibacter aphrophilus NJ8700	8	5
Pasteurella multocida subsp. multocida str. Pm70	14	9
Mannheimia succiniciproducens MBEL55E
Actinobacillus succinogenes 130Z
Haemophilus somnus 2336
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
omp	Haemophilus influenzae Rd KW20 Gene: HI1217: Outer membrane receptor protein	* Aggregatibacter aphrophilus NJ8700 Site: position = -214 score = 6.53227 sequence = TTATTTTTTATCATAAAATAA Gene: NT05HA_2308: Outer membrane receptor protein	4 Pasteurella multocida subsp. multocida str. Pm70* Gene: PM0745: Outer membrane receptor protein Gene: PM1081: Outer membrane receptor protein Site: position = -89 score = 6.75783 sequence = TTATTTTTTATTGAAAAATAA Gene: PM1428: Outer membrane receptor protein Site: position = -35 score = 6.57669 sequence = TTTTTTTTCATTGAAAAATAA Gene: PM1282: Outer membrane receptor protein	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	2 Haemophilus somnus 2336 Gene: HSM_0047: Outer membrane receptor protein Gene: HSM_1962: Outer membrane receptor protein	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0978: Outer membrane receptor protein	Haemophilus ducreyi 35000HP	2 Haemophilus parasuis SH0165 Gene: HAPS_1568: Outer membrane receptor protein Gene: HAPS_0355: Outer membrane receptor protein	Outer membrane receptor protein

CRON 2.
ptsH	Haemophilus influenzae Rd KW20 Gene: HI1713: Phosphocarrier protein of PTS system	* Aggregatibacter aphrophilus NJ8700 Site: position = -84 score = 5.58831 sequence = TTATTTTAGTGTTTTAAATAA Gene: NT05HA_0617: Phosphocarrier protein of PTS system	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -104 score = 6.36271 sequence = TTATTTTTTATCCAAAAATAA Gene: PM0898: Phosphocarrier protein of PTS system	Mannheimia succiniciproducens MBEL55E Gene: MS1510: Phosphocarrier protein of PTS system	Actinobacillus succinogenes 130Z Gene: Asuc_0994: Phosphocarrier protein of PTS system	Haemophilus somnus 2336 Gene: HSM_1009: Phosphocarrier protein of PTS system	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1373: Phosphocarrier protein of PTS system	Haemophilus ducreyi 35000HP Gene: HD0229: Phosphocarrier protein of PTS system	Haemophilus parasuis SH0165 Gene: HAPS_0960: Phosphocarrier protein of PTS system	Phosphocarrier protein of PTS system
ptsI	Haemophilus influenzae Rd KW20 Gene: HI1712: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0618: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0897: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Mannheimia succiniciproducens MBEL55E Gene: MS1509: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Actinobacillus succinogenes 130Z Gene: Asuc_0995: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Haemophilus somnus 2336 Gene: HSM_1010: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1374: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Haemophilus ducreyi 35000HP Gene: HD0228: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Haemophilus parasuis SH0165 Gene: HAPS_0959: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
crr	Haemophilus influenzae Rd KW20 Gene: HI1711: PTS system, glucose-specific IIA component (EC 2.7.1.69)	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0619: PTS system, glucose-specific IIA component (EC 2.7.1.69)	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0896: PTS system, glucose-specific IIA component (EC 2.7.1.69)	Mannheimia succiniciproducens MBEL55E Gene: MS1508: PTS system, glucose-specific IIA component (EC 2.7.1.69)	Actinobacillus succinogenes 130Z Gene: Asuc_0996: PTS system, glucose-specific IIA component (EC 2.7.1.69)	Haemophilus somnus 2336 Gene: HSM_1011: PTS system, glucose-specific IIA component (EC 2.7.1.69)	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1375: PTS system, glucose-specific IIA component (EC 2.7.1.69)	Haemophilus ducreyi 35000HP Gene: HD0227: PTS system, glucose-specific IIA component (EC 2.7.1.69)	Haemophilus parasuis SH0165 Gene: HAPS_0958: PTS system, glucose-specific IIA component (EC 2.7.1.69)	PTS system, glucose-specific IIA component (EC 2.7.1.69)

CRON 3.
exbB	Haemophilus influenzae Rd KW20 Gene: HI0253: Biopolymer transport protein ExbB	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1575: Biopolymer transport protein ExbB	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -33 score = 5.57644 sequence = TTATTTTGCGATACAAATTAA Gene: PM1186: Biopolymer transport protein ExbB	Mannheimia succiniciproducens MBEL55E Gene: MS0515: Biopolymer transport protein ExbB	Actinobacillus succinogenes 130Z Gene: Asuc_2012: Biopolymer transport protein ExbB	Haemophilus somnus 2336 Gene: HSM_1102: Biopolymer transport protein ExbB	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0078: Biopolymer transport protein ExbB	Haemophilus ducreyi 35000HP Gene: HD0329: Biopolymer transport protein ExbB	Haemophilus parasuis SH0165 Gene: HAPS_1366: Biopolymer transport protein ExbB	Biopolymer transport protein ExbB
exbD	Haemophilus influenzae Rd KW20 Gene: HI0252: Biopolymer transport protein ExbD/TolR	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1574: Biopolymer transport protein ExbD/TolR	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1187: Biopolymer transport protein ExbD/TolR	Mannheimia succiniciproducens MBEL55E Gene: MS0514: Biopolymer transport protein ExbD/TolR	Actinobacillus succinogenes 130Z Gene: Asuc_2011: Biopolymer transport protein ExbD/TolR	Haemophilus somnus 2336 Gene: HSM_1101: Biopolymer transport protein ExbD/TolR	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0077: Biopolymer transport protein ExbD/TolR	Haemophilus ducreyi 35000HP Gene: HD0328: Biopolymer transport protein ExbD/TolR	Haemophilus parasuis SH0165 Gene: HAPS_1365: Biopolymer transport protein ExbD/TolR	Biopolymer transport protein ExbD/TolR
tonB	Haemophilus influenzae Rd KW20 Gene: HI0251: Periplasmic binding protein TonB	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1573: Periplasmic binding protein TonB	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1188: Periplasmic binding protein TonB	Mannheimia succiniciproducens MBEL55E Gene: MS0513: Periplasmic binding protein TonB	Actinobacillus succinogenes 130Z Gene: Asuc_2010: Periplasmic binding protein TonB	Haemophilus somnus 2336 Gene: HSM_1100: Periplasmic binding protein TonB	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0076: Periplasmic binding protein TonB	Haemophilus ducreyi 35000HP Gene: HD0327: Periplasmic binding protein TonB	Haemophilus parasuis SH0165 Gene: HAPS_1364: Periplasmic binding protein TonB	Periplasmic binding protein TonB

CRON 4.
nagB	Haemophilus influenzae Rd KW20 Gene: HI0141: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0549: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -132 score = 6.43693 sequence = TTATTTTATAATGCAAAAAAA Gene: PM0875: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)	Mannheimia succiniciproducens MBEL55E Gene: MS2205: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336 Gene: HSM_1505: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1840: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)	Haemophilus ducreyi 35000HP Gene: HD1847: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)	Haemophilus parasuis SH0165 Gene: HAPS_2072: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagA	Haemophilus influenzae Rd KW20 Gene: HI0140: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0550: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0874: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Mannheimia succiniciproducens MBEL55E Gene: MS2204: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Actinobacillus succinogenes 130Z Gene: Asuc_1103: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Haemophilus somnus 2336 Gene: HSM_1504: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1841: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Haemophilus ducreyi 35000HP Gene: HD1845: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Haemophilus parasuis SH0165 Gene: HAPS_2071: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)

CRON 5.
rpmE1	Haemophilus influenzae Rd KW20	* Aggregatibacter aphrophilus NJ8700 Site: position = -96 score = 5.80047 sequence = TTATTTTTCTATTGAAAATAA Site: position = -33 score = 6.61808 sequence = TTATTTTTCACTAAAAAATAA Gene: NT05HA_1390: 50S ribosomal protein L31	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -98 score = 5.78562 sequence = TTATTTTCCCATAAAAAATAA Site: position = -34 score = 6.36271 sequence = TTATTTTTCAGAAAAAAATAA Gene: PM0220: 50S ribosomal protein L31	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1907: 50S ribosomal protein L31	Haemophilus ducreyi 35000HP Gene: HD1927: 50S ribosomal protein L31	Haemophilus parasuis SH0165 Gene: HAPS_1799: 50S ribosomal protein L31	50S ribosomal protein L31
rpmJ1	Haemophilus influenzae Rd KW20	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1389: ribosomal protein L36	Pasteurella multocida subsp. multocida str. Pm70	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1908: ribosomal protein L36	Haemophilus ducreyi 35000HP Gene: HD1926: ribosomal protein L36	Haemophilus parasuis SH0165 Gene: HAPS_1798: ribosomal protein L36	ribosomal protein L36

CRON 6.
nagE	Haemophilus influenzae Rd KW20	* Aggregatibacter aphrophilus NJ8700 Site: position = -36 score = 5.60996 sequence = TTATTTTATGGAATCAAAAAA Gene: NT05HA_0540: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -196 score = 6.43693 sequence = TTTTTTTGCATTATAAAATAA Gene: PM0876: PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	PTS system, N-acetylglucosamine-specific IIA component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69)

CRON 7.
znuA	Haemophilus influenzae Rd KW20 Gene: HI0119: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Aggregatibacter aphrophilus NJ8700 Site: position = -103 score = 6.35113 sequence = TTATTTTTCAAAATAAAAAAA Gene: NT05HA_1414: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -96 score = 6.23775 sequence = TTATTTTTTAGTTAAAAAAAA Gene: PM0926: Zinc ABC transporter, periplasmic-binding protein ZnuA	Mannheimia succiniciproducens MBEL55E Gene: MS1457: Zinc ABC transporter, periplasmic-binding protein ZnuA	Actinobacillus succinogenes 130Z Gene: Asuc_1782: Zinc ABC transporter, periplasmic-binding protein ZnuA	Haemophilus somnus 2336 Gene: HSM_0813: Zinc ABC transporter, periplasmic-binding protein ZnuA	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1492: Zinc ABC transporter, periplasmic-binding protein ZnuA	Haemophilus ducreyi 35000HP Gene: HD0198: Zinc ABC transporter, periplasmic-binding protein ZnuA	Haemophilus parasuis SH0165 Gene: HAPS_0913: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

CRON 8.
gdhA	Haemophilus influenzae Rd KW20 Gene: HI0189: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0070: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -134 score = 5.56514 sequence = TTTTTTTAAATAGACAAAAAA Gene: PM0043: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)	Mannheimia succiniciproducens MBEL55E Gene: MS0196: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)	Actinobacillus succinogenes 130Z Gene: Asuc_0375: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)	Haemophilus somnus 2336 Gene: HSM_0283: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0451: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	NADP-specific glutamate dehydrogenase (EC 1.4.1.4)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NagC - Pasteurellales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --