Regulog IscR - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia pseudomallei K96243 | 8 | 1 |
| Burkholderia mallei ATCC 23344 | 8 | 1 |
| Burkholderia sp. 383 | 8 | 1 |
| Burkholderia cepacia AMMD | 8 | 1 |
| Burkholderia vietnamiensis G4 | 8 | 1 |
| Burkholderia glumae BGR1 | 8 | 1 |
| Burkholderia xenovorans LB400 | 8 | 1 |
| Burkholderia phymatum STM815 | 8 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| iscR |
*
Burkholderia pseudomallei K96243 Site: position = -69 score = 7.46253 sequence = ATACTTGACTAAATTGGTCAAATAT Site: position = -42 score = 7.79991 sequence = ATACTTGACCAAAATCGTCAAGATT Gene: BPSL2290: Iron-sulfur cluster regulator IscR |
*
Burkholderia mallei ATCC 23344 Site: position = -69 score = 7.46253 sequence = ATACTTGACTAAATTGGTCAAATAT Site: position = -42 score = 7.70824 sequence = ATACTTGACAAAAATCGTCAAGATT Gene: BMA1709: Iron-sulfur cluster regulator IscR |
*
Burkholderia sp. 383 Site: position = -69 score = 7.80515 sequence = ATACTTGACTAAAATCGTCAAATAT Site: position = -42 score = 7.79991 sequence = ATACTTGACCAAAATCGTCAAGATT Gene: Bcep18194_A5433: Iron-sulfur cluster regulator IscR |
*
Burkholderia cepacia AMMD Site: position = -42 score = 7.79991 sequence = ATACTTGACCAAAATCGTCAAGATT Site: position = -69 score = 7.80515 sequence = ATACTTGACTAAAATCGTCAAATAT Gene: Bamb_2164: Iron-sulfur cluster regulator IscR |
*
Burkholderia vietnamiensis G4 Site: position = -42 score = 7.79991 sequence = ATACTTGACCAAAATCGTCAAGATT Site: position = -69 score = 7.51728 sequence = ATACTTGACTAAAAACGTCAAATAT Gene: Bcep1808_2206: Iron-sulfur cluster regulator IscR |
*
Burkholderia glumae BGR1 Site: position = -68 score = 6.87077 sequence = ATACTTGACTAAAAATGTCAGATAT Site: position = -41 score = 7.79991 sequence = ATACTTGACCAAAATCGTCAAGATT Gene: bglu_1g24710: Iron-sulfur cluster regulator IscR |
*
Burkholderia xenovorans LB400 Site: position = -68 score = 6.95083 sequence = ATACTTGACTAAATCGGTCATGTAT Site: position = -41 score = 7.2371 sequence = ATACTTGACAAAACTTGTCGAGAAT Gene: Bxe_A1552: Iron-sulfur cluster regulator IscR |
*
Burkholderia phymatum STM815 Site: position = -42 score = 7.32877 sequence = ATACTTGACCAAACTTGTCGAGAAT Site: position = -69 score = 7.12214 sequence = ATACTTGACTAAATCCGTCATGTAT Gene: Bphy_1459: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| iscS |
Gene: BPSL2289: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: BMA1708: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Bcep18194_A5432: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Bamb_2163: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Bcep1808_2205: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: bglu_1g24700: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Bxe_A1553: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Bphy_1458: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
Gene: BPSL2288: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: BMA1707: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Bcep18194_A5431: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Bamb_2162: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Bcep1808_2204: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: bglu_1g24690: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Bxe_A1554: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Bphy_1457: Iron-sulfur cluster assembly scaffold protein IscU |
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
Gene: BPSL2287: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: BMA1706: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Bcep18194_A5430: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Bamb_2161: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Bcep1808_2203: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: bglu_1g24680: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Bxe_A1555: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Bphy_1456: Iron binding protein IscA for iron-sulfur cluster assembly |
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
Gene: BPSL2286: Chaperone protein HscB |
Gene: BMA1705: Chaperone protein HscB |
Gene: Bcep18194_A5429: Chaperone protein HscB |
Gene: Bamb_2160: Chaperone protein HscB |
Gene: Bcep1808_2202: Chaperone protein HscB |
Gene: bglu_1g24670: Chaperone protein HscB |
Gene: Bxe_A1556: Chaperone protein HscB |
Gene: Bphy_1455: Chaperone protein HscB |
Chaperone protein HscB |
| hscA |
Gene: BPSL2285: Chaperone protein HscA |
Gene: BMA1704: Chaperone protein HscA |
Gene: Bcep18194_A5428: Chaperone protein HscA |
Gene: Bamb_2159: Chaperone protein HscA |
Gene: Bcep1808_2201: Chaperone protein HscA |
Gene: bglu_1g24660: Chaperone protein HscA |
Gene: Bxe_A1557: Chaperone protein HscA |
Gene: Bphy_1454: Chaperone protein HscA |
Chaperone protein HscA |
| fdx |
Gene: BPSL2284: Ferredoxin, 2Fe-2S type, ISC system |
Gene: BMA1703: Ferredoxin, 2Fe-2S type, ISC system |
Gene: Bcep18194_A5427: Ferredoxin, 2Fe-2S type, ISC system |
Gene: Bamb_2158: Ferredoxin, 2Fe-2S type, ISC system |
Gene: Bcep1808_2200: Ferredoxin, 2Fe-2S type, ISC system |
Gene: bglu_1g24650: Ferredoxin, 2Fe-2S type, ISC system |
Gene: Bxe_A1558: Ferredoxin, 2Fe-2S type, ISC system |
Gene: Bphy_1453: Ferredoxin, 2Fe-2S type, ISC system |
Ferredoxin, 2Fe-2S type, ISC system |
| yfhJ |
Gene: BPSL2283: putative Fe-S cluster assembly protein |
Gene: BMA1702: putative Fe-S cluster assembly protein |
Gene: Bcep18194_A5426: putative Fe-S cluster assembly protein |
Gene: Bamb_2157: putative Fe-S cluster assembly protein |
Gene: Bcep1808_2199: putative Fe-S cluster assembly protein |
Gene: bglu_1g24640: putative Fe-S cluster assembly protein |
Gene: Bxe_A1559: putative Fe-S cluster assembly protein |
Gene: Bphy_1452: putative Fe-S cluster assembly protein |
putative Fe-S cluster assembly protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |