Regulon of IscR in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_1g24710
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Burkholderia
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 6.9 Sequence: ATACTTGACTAAAAATGTCAGATAT Position: -41 Score: 7.8 Sequence: ATACTTGACCAAAATCGTCAAGATT Locus tag: bglu_1g24710 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: bglu_1g24700 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: bglu_1g24690 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: bglu_1g24680 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: bglu_1g24670 Name: hscB Funciton: Chaperone protein HscB Locus tag: bglu_1g24660 Name: hscA Funciton: Chaperone protein HscA Locus tag: bglu_1g24650 Name: fdx Funciton: Ferredoxin, 2Fe-2S type, ISC system Locus tag: bglu_1g24640 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	bglu_1g24710	iscR	Iron-sulfur cluster regulator IscR
	bglu_1g24700	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	bglu_1g24690	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	bglu_1g24680	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	bglu_1g24670	hscB	Chaperone protein HscB
	bglu_1g24660	hscA	Chaperone protein HscA
	bglu_1g24650	fdx	Ferredoxin, 2Fe-2S type, ISC system
	bglu_1g24640	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD