Regulon of IscR in Burkholderia cepacia AMMD

Properties
Regulator type:	Transcription factor
TF locus tag:	Bamb_2164
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Burkholderia
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 7.8 Sequence: ATACTTGACTAAAATCGTCAAATAT Position: -42 Score: 7.8 Sequence: ATACTTGACCAAAATCGTCAAGATT Locus tag: Bamb_2164 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Bamb_2163 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Bamb_2162 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Bamb_2161 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Bamb_2160 Name: hscB Funciton: Chaperone protein HscB Locus tag: Bamb_2159 Name: hscA Funciton: Chaperone protein HscA Locus tag: Bamb_2158 Name: fdx Funciton: Ferredoxin, 2Fe-2S type, ISC system Locus tag: Bamb_2157 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	Bamb_2164	iscR	Iron-sulfur cluster regulator IscR
	Bamb_2163	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Bamb_2162	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Bamb_2161	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Bamb_2160	hscB	Chaperone protein HscB
	Bamb_2159	hscA	Chaperone protein HscA
	Bamb_2158	fdx	Ferredoxin, 2Fe-2S type, ISC system
	Bamb_2157	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD