Regulog SahR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - SahR/SamR
- By TF family - ArsR
- By effector - S-adenosylhomocysteine
- By pathway - Methionine metabolism
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | 2 | 1 |
| Pseudomonas entomophila L48 | 2 | 1 |
| Pseudomonas putida KT2440 | 2 | 1 |
| Pseudomonas syringae pv. tomato str. DC3000 | 2 | 1 |
| Pseudomonas fluorescens Pf-5 | 2 | 1 |
| Pseudomonas mendocina ymp | 2 | 1 |
| Pseudomonas stutzeri A1501 | 2 | 1 |
| Azotobacter vinelandii AvOP | 2 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| sahR |
*
Pseudomonas aeruginosa PAO1 Site: position = -62 score = 6.94857 sequence = ATATCAAAAATTTTTGATAC Gene: PA0547: Transcriptional regulator of methionine metabolism, ArsR family |
*
Pseudomonas entomophila L48 Site: position = -62 score = 7.16024 sequence = ATATCAAAACTTTTTGATAT Gene: PSEEN5025: Transcriptional regulator of methionine metabolism, ArsR family |
*
Pseudomonas putida KT2440 Site: position = -62 score = 7.16024 sequence = ATATCAAAACTTTTTGATAT Gene: PP4966: Transcriptional regulator of methionine metabolism, ArsR family |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -62 score = 7.16024 sequence = ATATCAAAACTTTTTGATAT Gene: PSPTO0384: Transcriptional regulator of methionine metabolism, ArsR family |
*
Pseudomonas fluorescens Pf-5 Site: position = -35 score = 7.16024 sequence = ATATCAAAACTTTTTGATAT Gene: PFL_5787: Transcriptional regulator of methionine metabolism, ArsR family |
*
Pseudomonas mendocina ymp Site: position = -62 score = 7.16024 sequence = ATATCAAAACTTTTTGATAT Gene: Pmen_0455: Transcriptional regulator of methionine metabolism, ArsR family |
*
Pseudomonas stutzeri A1501 Site: position = -63 score = 7.16024 sequence = ATATCAAAACTTTTTGATAT Gene: PST_3925: Transcriptional regulator of methionine metabolism, ArsR family |
*
Azotobacter vinelandii AvOP Site: position = -62 score = 6.86165 sequence = ATATCAAAACTTTTTGATAC Gene: Avin_05540: Transcriptional regulator of methionine metabolism, ArsR family |
Transcriptional regulator of methionine metabolism, ArsR family |
| metK |
Gene: PA0546: S-adenosylmethionine synthetase (EC 2.5.1.6) |
Gene: PSEEN5026: S-adenosylmethionine synthetase (EC 2.5.1.6) |
Gene: PP4967: S-adenosylmethionine synthetase (EC 2.5.1.6) |
Gene: PSPTO0383: S-adenosylmethionine synthetase (EC 2.5.1.6) |
Gene: PFL_5788: S-adenosylmethionine synthetase (EC 2.5.1.6) |
Gene: Pmen_0454: S-adenosylmethionine synthetase (EC 2.5.1.6) |
Gene: PST_3926: S-adenosylmethionine synthetase (EC 2.5.1.6) |
Gene: Avin_05530: S-adenosylmethionine synthetase (EC 2.5.1.6) |
S-adenosylmethionine synthetase (EC 2.5.1.6) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |