Regulon of SahR in Pseudomonas syringae pv. tomato str. DC3000

Properties
Regulator type:	Transcription factor
TF locus tag:	PSPTO0384
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Methionine metabolism
Effector:	S-adenosylhomocysteine
Regulog:	SahR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - SahR/SamR
By TF family - ArsR
By effector - S-adenosylhomocysteine
By pathway - Methionine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 7.2 Sequence: ATATCAAAACTTTTTGATAT Locus tag: PSPTO0384 Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family Locus tag: PSPTO0383 Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
	PSPTO0384	sahR	Transcriptional regulator of methionine metabolism, ArsR family
	PSPTO0383	metK	S-adenosylmethionine synthetase (EC 2.5.1.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD