Regulog NsrR - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - NsrR
- By TF family - Rrf2
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | 2 | 1 |
| Acinetobacter baumannii AB0057 | 2 | 1 |
| Psychrobacter arcticum 273-4 | ||
| Psychrobacter sp. PRwf-1 | 3 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| norB |
|
|
|
*
Psychrobacter sp. PRwf-1 Site: position = -188 score = 6.54553 sequence = ACATTCATTTTAAATGAATGT Site: position = -53 score = 6.7784 sequence = ACATTCATTTTAAATGAATCT Gene: PsycPRwf_1520: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent |
Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent |
| CRON 2. | |||||
| nnrS |
|
|
Gene: Psyc_1348: NnrS protein involved in response to NO |
*
Psychrobacter sp. PRwf-1 Site: position = -135 score = 6.27423 sequence = ACATTCATTATAAATACATCT Gene: PsycPRwf_0765: NnrS protein involved in response to NO |
NnrS protein involved in response to NO |
| CRON 3. | |||||
| hmp |
*
Acinetobacter sp. ADP1 Site: position = -72 score = 6.35056 sequence = AGATGCATTGCAAATACATCT Site: position = -47 score = 5.41848 sequence = AAATGTATTTTGAATATATCT Gene: ACIAD3226: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
*
Acinetobacter baumannii AB0057 Site: position = -49 score = 6.68081 sequence = AGATGTATTTTAAATACATCT Gene: AB57_3535: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
|
*
Psychrobacter sp. PRwf-1 Site: position = -142 score = 6.90889 sequence = AGATTCATTTGAAATGAATCT Gene: PsycPRwf_0670: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
| nsrR |
Gene: ACIAD3227: Nitrite-sensitive transcriptional repressor NsrR |
Gene: AB57_3536: Nitrite-sensitive transcriptional repressor NsrR |
|
Gene: PsycPRwf_0763: Nitrite-sensitive transcriptional repressor NsrR |
Nitrite-sensitive transcriptional repressor NsrR |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |