Regulon of NsrR in Acinetobacter baumannii AB0057

Properties
Regulator type:	Transcription factor
TF locus tag:	AB57_3536
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Moraxellaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.7 Sequence: AGATGTATTTTAAATACATCT Locus tag: AB57_3535 Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) Locus tag: AB57_3536 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR
	AB57_3535	hmp	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
	AB57_3536	nsrR	Nitrite-sensitive transcriptional repressor NsrR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD