Regulon of NsrR in Psychrobacter sp. PRwf-1

Properties
Regulator type:	Transcription factor
TF locus tag:	PsycPRwf_0763
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Moraxellaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -135 Score: 6.3 Sequence: ACATTCATTATAAATACATCT Locus tag: PsycPRwf_0765 Name: nnrS Funciton: NnrS protein involved in response to NO
	PsycPRwf_0765	nnrS	NnrS protein involved in response to NO
Position: -188 Score: 6.5 Sequence: ACATTCATTTTAAATGAATGT Position: -53 Score: 6.8 Sequence: ACATTCATTTTAAATGAATCT Locus tag: PsycPRwf_1520 Name: norB Funciton: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
	PsycPRwf_1520	norB	Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
Position: -142 Score: 6.9 Sequence: AGATTCATTTGAAATGAATCT Locus tag: PsycPRwf_0670 Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
	PsycPRwf_0670	hmp	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD