Regulog YybA - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | MarR |
| Regulation mode: | repressor |
| Biological process: | Polyamine homeostasis |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - MarR
- By pathway - Polyamine homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | 4 | 4 |
| Bacillus cereus ATCC 14579 | ||
| Bacillus clausii KSM-K16 | 3 | 2 |
| Bacillus halodurans C-125 | 3 | 2 |
| Bacillus licheniformis DSM 13 | 4 | 2 |
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | 5 | 3 |
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | 2 | 1 |
| Paenibacillus sp. JDR-2 | 2 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| yyaT |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -100 score = 6.91734 sequence = TTTTTGTTGCATATGCAATATAAT Gene: RBAM_037800: Putative GCN5-related N-acetyltransferase |
Gene: BC2797: Putative GCN5-related N-acetyltransferase |
Gene: ABC1921: Putative GCN5-related N-acetyltransferase |
|
|
|
*2
Bacillus subtilis subsp. subtilis str. 168 Site: position = -100 score = 7.23413 sequence = TTTTTGTTGCAATTACAACAAAAA Gene: BSU40720: Putative GCN5-related N-acetyltransferase Gene: BSU40680: Putative GCN5-related N-acetyltransferase |
|
|
*2
Paenibacillus sp. JDR-2 Site: position = -109 score = 6.65297 sequence = AATTTGTTGCATTTACAACAATAA Gene: Pjdr2_5022: Putative GCN5-related N-acetyltransferase Gene: Pjdr2_1368: Putative GCN5-related N-acetyltransferase |
Putative GCN5-related N-acetyltransferase |
| yyaS |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -46 score = 7.049 sequence = ATTTTGTTGTATTTGCAACATAAA Site: position = -93 score = 6.54195 sequence = TTTTTGTTGTATTTGCAATGAAAA Gene: RBAM_031710: Putative integral inner membrane protein |
|
|
*
Bacillus halodurans C-125 Site: position = -44 score = 6.96747 sequence = AATTTGTTGTAAATGCAACAAAAA Site: position = -91 score = 6.63724 sequence = TTTATATTGCAAATGCAACAATAA Gene: BH3078: Putative integral inner membrane protein |
*
Bacillus licheniformis DSM 13 Site: position = -92 score = 6.91734 sequence = TTTTTGTTGCAAATGCAATATAAT Site: position = -45 score = 6.75357 sequence = ATATTGTTGCATTTGCAATAAAAA Gene: BLi00580: Putative integral inner membrane protein |
|
Gene: BSU40730: Putative integral inner membrane protein |
|
|
|
Putative integral inner membrane protein |
| CRON 2. | ||||||||||||
| ABC0420 |
|
|
|
*
Bacillus clausii KSM-K16 Site: position = -79 score = 6.87325 sequence = TTTTTGTTGCATTTTCAACAAAAA Gene: ABC0420: Multidrug resistance protein, efflux transporter |
|
|
|
|
|
|
|
Multidrug resistance protein, efflux transporter |
| CRON 3. | ||||||||||||
| yybA |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -44 score = 6.91734 sequence = ATTATATTGCATATGCAACAAAAA Gene: RBAM_037790: Transcriptional regulator, MarR family |
|
*
Bacillus clausii KSM-K16 Site: position = -45 score = 7.23413 sequence = TTTTTGTTGCATTTACAACAAAAA Site: position = -90 score = 6.79652 sequence = TTTTTATTGCAAATACAATAAAAT Gene: ABC3242: Transcriptional regulator, MarR family |
*
Bacillus halodurans C-125 Site: position = -42 score = 6.63724 sequence = TTATTGTTGCATTTGCAATATAAA Site: position = -89 score = 6.96747 sequence = TTTTTGTTGCATTTACAACAAATT Gene: BH3077: Transcriptional regulator, MarR family |
*
Bacillus licheniformis DSM 13 Site: position = -42 score = 6.91734 sequence = ATTATATTGCATTTGCAACAAAAA Site: position = -89 score = 6.75357 sequence = TTTTTATTGCAAATGCAACAATAT Gene: BLi00581: Transcriptional regulator, MarR family |
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -43 score = 7.23413 sequence = TTTTTGTTGTAATTGCAACAAAAA Gene: BSU40710: Transcriptional regulator, MarR family |
|
*
Oceanobacillus iheyensis HTE831 Site: position = -43 score = 6.60659 sequence = TAAATGTTGCATTTGCAACAAAAA Site: position = -91 score = 7.049 sequence = TTTTTGTTGCAAATACAACATAAT Gene: OB1246: Transcriptional regulator, MarR family |
*
Paenibacillus sp. JDR-2 Site: position = -47 score = 6.65297 sequence = TTATTGTTGTAAATGCAACAAATT Gene: Pjdr2_5021: Transcriptional regulator, MarR family |
Transcriptional regulator, MarR family |
| paiA |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -105 score = 7.049 sequence = TTTATGTTGCAAATACAACAAAAT Site: position = -58 score = 6.54195 sequence = TTTTCATTGCAAATACAACAAAAA Gene: RBAM_031720: N1-spermidine/spermine acetyltransferase |
|
Gene: ABC3243: N1-spermidine/spermine acetyltransferase |
Gene: BH3076: N1-spermidine/spermine acetyltransferase |
Gene: BLi00582: N1-spermidine/spermine acetyltransferase |
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -151 score = 6.96372 sequence = ATTTTATTGCATTTACAACAAAAT Site: position = -199 score = 6.16746 sequence = TTTTTGTTGTAAATACAGCAAAGT Gene: BSU32150: N1-spermidine/spermine acetyltransferase |
|
Gene: OB1247: N1-spermidine/spermine acetyltransferase |
|
N1-spermidine/spermine acetyltransferase |
| paiB |
|
|
|
|
|
Gene: BLi00583: Putative FMN-binding protein |
|
Gene: BSU32140: Putative FMN-binding protein |
|
|
|
Putative FMN-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |