Regulon of YybA in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC3242
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Polyamine homeostasis
Effector:
Regulog:	YybA - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MarR
By pathway - Polyamine homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 6.8 Sequence: TTTTTATTGCAAATACAATAAAAT Position: -45 Score: 7.2 Sequence: TTTTTGTTGCATTTACAACAAAAA Locus tag: ABC3242 Name: yybA Funciton: Transcriptional regulator, MarR family Locus tag: ABC3243 Name: paiA Funciton: N1-spermidine/spermine acetyltransferase
	ABC3242	yybA	Transcriptional regulator, MarR family
	ABC3243	paiA	N1-spermidine/spermine acetyltransferase
Position: -79 Score: 6.9 Sequence: TTTTTGTTGCATTTTCAACAAAAA Locus tag: ABC0420 Name: ABC0420 Funciton: Multidrug resistance protein, efflux transporter
	ABC0420	ABC0420	Multidrug resistance protein, efflux transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD