Regulon of YybA in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_037790
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Polyamine homeostasis
Effector:
Regulog:	YybA - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MarR
By pathway - Polyamine homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 7 Sequence: TTTATGTTGCAAATACAACAAAAT Position: -58 Score: 6.5 Sequence: TTTTCATTGCAAATACAACAAAAA Locus tag: RBAM_031720 Name: paiA Funciton: N1-spermidine/spermine acetyltransferase
	RBAM_031720	paiA	N1-spermidine/spermine acetyltransferase
Position: -44 Score: 6.9 Sequence: ATTATATTGCATATGCAACAAAAA Locus tag: RBAM_037790 Name: yybA Funciton: Transcriptional regulator, MarR family
	RBAM_037790	yybA	Transcriptional regulator, MarR family
Position: -93 Score: 6.5 Sequence: TTTTTGTTGTATTTGCAATGAAAA Position: -46 Score: 7 Sequence: ATTTTGTTGTATTTGCAACATAAA Locus tag: RBAM_031710 Name: yyaS Funciton: Putative integral inner membrane protein
	RBAM_031710	yyaS	Putative integral inner membrane protein
Position: -100 Score: 6.9 Sequence: TTTTTGTTGCATATGCAATATAAT Locus tag: RBAM_037800 Name: yyaT Funciton: Putative GCN5-related N-acetyltransferase
	RBAM_037800	yyaT	Putative GCN5-related N-acetyltransferase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD