Regulon of YybA in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_5021
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Polyamine homeostasis
Effector:
Regulog:	YybA - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MarR
By pathway - Polyamine homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 6.7 Sequence: TTATTGTTGTAAATGCAACAAATT Locus tag: Pjdr2_5021 Name: yybA Funciton: Transcriptional regulator, MarR family
	Pjdr2_5021	yybA	Transcriptional regulator, MarR family
Position: -109 Score: 6.7 Sequence: AATTTGTTGCATTTACAACAATAA Locus tag: Pjdr2_5022 Name: yyaT Funciton: Putative GCN5-related N-acetyltransferase
	Pjdr2_5022	yyaT	Putative GCN5-related N-acetyltransferase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD