Regulon of YybA in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH3077
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Polyamine homeostasis
Effector:
Regulog:	YybA - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MarR
By pathway - Polyamine homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 7 Sequence: TTTTTGTTGCATTTACAACAAATT Position: -42 Score: 6.6 Sequence: TTATTGTTGCATTTGCAATATAAA Locus tag: BH3077 Name: yybA Funciton: Transcriptional regulator, MarR family Locus tag: BH3076 Name: paiA Funciton: N1-spermidine/spermine acetyltransferase
	BH3077	yybA	Transcriptional regulator, MarR family
	BH3076	paiA	N1-spermidine/spermine acetyltransferase
Position: -91 Score: 6.6 Sequence: TTTATATTGCAAATGCAACAATAA Position: -44 Score: 7 Sequence: AATTTGTTGTAAATGCAACAAAAA Locus tag: BH3078 Name: yyaS Funciton: Putative integral inner membrane protein
	BH3078	yyaS	Putative integral inner membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD