Regulog YdfD/YisV - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/MocR |
| Regulation mode: | repressor (activator) |
| Biological process: | Metabolite transport |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/MocR
- By pathway - Metabolite transport
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 4 | 4 |
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus licheniformis DSM 13 | ||
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | 4 | 4 |
| Bacillus halodurans C-125 | 2 | 2 |
| Bacillus clausii KSM-K16 | 2 | 2 |
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 | 2 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| yisU |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -39 score = 5.9641 sequence = TGGCTGGTTCCTAACCCAACCAAATGGCTGG Gene: BSU10870: Hypothetical efflux transporter, LysE family |
|
Gene: BPUM_2599: Hypothetical efflux transporter, LysE family |
|
|
|
*
Bacillus cereus ATCC 14579 Site: position = -94 score = 6.30643 sequence = TGGTTGGTAACCTCCCCAACCATATGGATGG Gene: BC1986: Hypothetical efflux transporter, LysE family |
*
Bacillus halodurans C-125 Site: position = -90 score = 5.7916 sequence = TGGTTGGCCTCAAGCTAGGCGAACTGGATGA Gene: BH0431: Hypothetical efflux transporter, LysE family |
*
Bacillus clausii KSM-K16 Site: position = -88 score = 6.86067 sequence = TGGTTGGGTCTTTTCCCAGCCAATTGGTGGT Gene: ABC1202: Hypothetical efflux transporter, LysE family |
|
*
Paenibacillus sp. JDR-2 Site: position = -97 score = 6.41978 sequence = TGGTTGGTATGCGGGCCAACCATTTGGATGG Gene: Pjdr2_2788: Hypothetical efflux transporter, LysE family |
Hypothetical efflux transporter, LysE family |
| CRON 2. | ||||||||||||
| ydfC |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -108 score = 6.95777 sequence = TGGTTGGGTCAAAATCTATTGAACTGGTTGA Gene: BSU05360: Permease of the drug/metabolite transporter (DMT) superfamily |
|
|
|
|
|
*
Bacillus cereus ATCC 14579 Site: position = -116 score = 6.56481 sequence = TGGTTGGTTTTTCCGATAAATAACTGGTTGA Gene: BC2681: Permease of the drug/metabolite transporter (DMT) superfamily |
|
Gene: ABC0276: Permease of the drug/metabolite transporter (DMT) superfamily |
|
|
Permease of the drug/metabolite transporter (DMT) superfamily |
| CRON 3. | ||||||||||||
| ydfD |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -55 score = -0.562058 sequence = TCAACCAGTTCAATAGATTTTGACCCAACCA Gene: BSU05370: Transcriptional regulator, GntR (GabR/MocR) family |
|
|
|
|
|
*
Bacillus cereus ATCC 14579 Site: position = -67 score = 0.303209 sequence = TCAACCAGTTATTTATCGGAAAAACCAACCA Gene: BC2680: Transcriptional regulator, GntR (GabR/MocR) family |
|
|
|
|
Transcriptional regulator, GntR (GabR/MocR) family |
| CRON 4. | ||||||||||||
| yisV |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -58 score = -2.21839 sequence = CCAGCCATTTGGTTGGGTTAGGAACCAGCCA Gene: BSU10880: Transcriptional regulator, GntR (GabR/MocR) family |
|
|
|
|
|
*
Bacillus cereus ATCC 14579 Site: position = -52 score = -1.29709 sequence = CCATCCATATGGTTGGGGAGGTTACCAACCA Gene: BC1987: Transcriptional regulator, GntR (GabR/MocR) family |
*
Bacillus halodurans C-125 Site: position = -56 score = -0.93057 sequence = TCATCCAGTTCGCCTAGCTTGAGGCCAACCA Gene: BH0432: Transcriptional regulator, GntR (GabR/MocR) family |
*
Bacillus clausii KSM-K16 Site: position = -50 score = -1.88343 sequence = ACCACCAATTGGCTGGGAAAAGACCCAACCA Gene: ABC1201: Transcriptional regulator, GntR (GabR/MocR) family |
|
*
Paenibacillus sp. JDR-2 Site: position = -60 score = -1.33071 sequence = CCATCCAAATGGTTGGCCCGCATACCAACCA Gene: Pjdr2_2789: Transcriptional regulator, GntR (GabR/MocR) family |
Transcriptional regulator, GntR (GabR/MocR) family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |