Regulon of YdfD/YisV in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC1987, BC2680
Regulator family:	GntR/MocR
Regulation mode:	repressor (activator)
Biological process:	Metabolite transport
Effector:
Regulog:	YdfD/YisV - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/MocR
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 0.3 Sequence: TCAACCAGTTATTTATCGGAAAAACCAACCA Locus tag: BC2680 Name: ydfD Funciton: Transcriptional regulator, GntR (GabR/MocR) family
	BC2680	ydfD	Transcriptional regulator, GntR (GabR/MocR) family
Position: -52 Score: -1.3 Sequence: CCATCCATATGGTTGGGGAGGTTACCAACCA Locus tag: BC1987 Name: yisV Funciton: Transcriptional regulator, GntR (GabR/MocR) family
	BC1987	yisV	Transcriptional regulator, GntR (GabR/MocR) family
Position: -116 Score: 6.6 Sequence: TGGTTGGTTTTTCCGATAAATAACTGGTTGA Locus tag: BC2681 Name: ydfC Funciton: Permease of the drug/metabolite transporter (DMT) superfamily
	BC2681	ydfC	Permease of the drug/metabolite transporter (DMT) superfamily
Position: -94 Score: 6.3 Sequence: TGGTTGGTAACCTCCCCAACCATATGGATGG Locus tag: BC1986 Name: yisU Funciton: Hypothetical efflux transporter, LysE family
	BC1986	yisU	Hypothetical efflux transporter, LysE family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD