Regulon of YdfD/YisV in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC1201
Regulator family:	GntR/MocR
Regulation mode:	repressor (activator)
Biological process:	Metabolite transport
Effector:
Regulog:	YdfD/YisV - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/MocR
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: -1.9 Sequence: ACCACCAATTGGCTGGGAAAAGACCCAACCA Locus tag: ABC1201 Name: yisV Funciton: Transcriptional regulator, GntR (GabR/MocR) family
	ABC1201	yisV	Transcriptional regulator, GntR (GabR/MocR) family
Position: -88 Score: 6.9 Sequence: TGGTTGGGTCTTTTCCCAGCCAATTGGTGGT Locus tag: ABC1202 Name: yisU Funciton: Hypothetical efflux transporter, LysE family
	ABC1202	yisU	Hypothetical efflux transporter, LysE family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD