Regulon of YdfD/YisV in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU10880, BSU05370
Regulator family:	GntR/MocR
Regulation mode:	repressor (activator)
Biological process:	Metabolite transport
Effector:
Regulog:	YdfD/YisV - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/MocR
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: -2.2 Sequence: CCAGCCATTTGGTTGGGTTAGGAACCAGCCA Locus tag: BSU10880 Name: yisV Funciton: Transcriptional regulator, GntR (GabR/MocR) family
	BSU10880	yisV	Transcriptional regulator, GntR (GabR/MocR) family
Position: -55 Score: -0.6 Sequence: TCAACCAGTTCAATAGATTTTGACCCAACCA Locus tag: BSU05370 Name: ydfD Funciton: Transcriptional regulator, GntR (GabR/MocR) family
	BSU05370	ydfD	Transcriptional regulator, GntR (GabR/MocR) family
Position: -39 Score: 6 Sequence: TGGCTGGTTCCTAACCCAACCAAATGGCTGG Locus tag: BSU10870 Name: yisU Funciton: Hypothetical efflux transporter, LysE family
	BSU10870	yisU	Hypothetical efflux transporter, LysE family
Position: -108 Score: 7 Sequence: TGGTTGGGTCAAAATCTATTGAACTGGTTGA Locus tag: BSU05360 Name: ydfC Funciton: Permease of the drug/metabolite transporter (DMT) superfamily
	BSU05360	ydfC	Permease of the drug/metabolite transporter (DMT) superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD