Regulog BltR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - MerR
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 2 | 1 |
| Bacillus amyloliquefaciens FZB42 | 2 | 1 |
| Bacillus pumilus SAFR-032 | 1 | 1 |
| Bacillus licheniformis DSM 13 | ||
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | 1 | 1 |
| Bacillus clausii KSM-K16 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BH4045 |
|
|
|
|
|
|
|
*
Bacillus halodurans C-125 Site: position = -65 score = 5.85514 sequence = GACTATCGTGTTACACCACACCT Gene: BH4045: MATE family multidrug export protein |
|
|
|
MATE family multidrug export protein |
| CRON 2. | ||||||||||||
| yrkN |
Gene: BSU26450: Possible acetyltransferase |
Gene: RBAM_024110: Possible acetyltransferase |
*2
Bacillus pumilus SAFR-032 Site: position = -32 score = 5.74334 sequence = GACTATGGAGTTACTCCACCCTT Gene: BPUM_1819: Possible acetyltransferase Gene: BPUM_2354: Possible acetyltransferase |
|
|
|
|
|
|
|
|
Possible acetyltransferase |
| CRON 3. | ||||||||||||
| bltD |
Gene: BSU26600: Spermine/spermidine acetyltransferase |
*
Bacillus amyloliquefaciens FZB42 Site: position = -120 score = 6.38308 sequence = GACTATACGGTAACCATATCCTT Gene: RBAM_006040: Spermine/spermidine acetyltransferase |
|
|
|
|
|
|
|
Gene: OB1723: Spermine/spermidine acetyltransferase |
|
Spermine/spermidine acetyltransferase |
| ydhB |
Gene: BSU05690: Hypothetical secreted protein |
Gene: RBAM_006030: Hypothetical secreted protein |
Gene: BPUM_3167: Hypothetical secreted protein |
|
|
|
Gene: BC3673: Hypothetical secreted protein |
|
|
|
Gene: Pjdr2_2960: Hypothetical secreted protein |
Hypothetical secreted protein |
| blt |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -104 score = 6.55373 sequence = GACTATACGGTAACCATATACCT Gene: BSU26590: Multidrug resistance protein, major facilitator (MFS) superfamily |
Gene: RBAM_010750: Multidrug resistance protein, major facilitator (MFS) superfamily |
Gene: BPUM_0475: Multidrug resistance protein, major facilitator (MFS) superfamily |
|
|
|
Gene: BC0855: Multidrug resistance protein, major facilitator (MFS) superfamily |
|
Gene: ABC1965: Multidrug resistance protein, major facilitator (MFS) superfamily |
|
Gene: Pjdr2_5113: Multidrug resistance protein, major facilitator (MFS) superfamily |
Multidrug resistance protein, major facilitator (MFS) superfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |