Regulon of BltR in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_006050
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	BltR - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MerR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -120 Score: 6.4 Sequence: GACTATACGGTAACCATATCCTT Locus tag: RBAM_006040 Name: bltD Funciton: Spermine/spermidine acetyltransferase Locus tag: RBAM_006030 Name: ydhB Funciton: Hypothetical secreted protein
	RBAM_006040	bltD	Spermine/spermidine acetyltransferase
	RBAM_006030	ydhB	Hypothetical secreted protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD