Regulon of BltR in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_1818
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Multidrug resistance
Effector:
Regulog:	BltR - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MerR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 5.7 Sequence: GACTATGGAGTTACTCCACCCTT Locus tag: BPUM_1819 Name: yrkN Funciton: Possible acetyltransferase
	BPUM_1819	yrkN	Possible acetyltransferase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD