Regulon of BltR in Bacillus halodurans C-125
| Regulator type: | Transcription factor |
| TF locus tag: | BH4046 |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Regulog: | BltR - Bacillales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - MerR
- By pathway - Multidrug resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -65
Score: 5.9 Sequence: GACTATCGTGTTACACCACACCT
Locus tag: BH4045
Name: BH4045 Funciton: MATE family multidrug export protein |
|||
|
BH4045
|
MATE family multidrug export protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |