Regulog SoxR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 2 | 2 |
| Salmonella typhimurium LT2 | 2 | 2 |
| Citrobacter koseri ATCC BAA-895 | 2 | 2 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 3 | 3 |
| Enterobacter sp. 638 | 3 | 3 |
| Erwinia amylovora ATCC 49946 | 2 | 2 |
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Edwardsiella tarda EIB202 | ||
| Proteus mirabilis HI4320 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| soxS |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -75 score = 7.36766 sequence = ACCTCAAGTTAACTTGAGGA Gene: b4062: Transcriptional activator of superoxide response regulon, AraC family |
*
Salmonella typhimurium LT2 Site: position = -76 score = 7.36766 sequence = ACCTCAAGTTAACTTGAGGA Gene: STM4265: Transcriptional activator of superoxide response regulon, AraC family |
*
Citrobacter koseri ATCC BAA-895 Site: position = -76 score = 7.36766 sequence = ACCTCAAGTTAACTTGAGGA Gene: CKO_03828: Transcriptional activator of superoxide response regulon, AraC family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -74 score = 7.36766 sequence = ACCTCAAGTTAACTTGAGGA Gene: KPN_04462: Transcriptional activator of superoxide response regulon, AraC family |
*
Enterobacter sp. 638 Site: position = -87 score = 7.36766 sequence = ACCTCAAGTTAACTTGAGGA Gene: Ent638_0266: Transcriptional activator of superoxide response regulon, AraC family |
*
Erwinia amylovora ATCC 49946 Site: position = -92 score = 7.0704 sequence = ACCTCAAGTAAACTTGAGGA Gene: EAM_0316: Transcriptional activator of superoxide response regulon, AraC family |
|
|
|
|
|
|
Transcriptional activator of superoxide response regulon, AraC family |
| CRON 2. | |||||||||||||
| soxR |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -30 score = 7.36766 sequence = TCCTCAAGTTAACTTGAGGT Gene: b4063: Redox-sensitive transcriptional activator, MerR family |
*
Salmonella typhimurium LT2 Site: position = -30 score = 7.36766 sequence = TCCTCAAGTTAACTTGAGGT Gene: STM4266: Redox-sensitive transcriptional activator, MerR family |
*
Citrobacter koseri ATCC BAA-895 Site: position = -30 score = 7.36766 sequence = TCCTCAAGTTAACTTGAGGT Gene: CKO_03827: Redox-sensitive transcriptional activator, MerR family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -57 score = 7.36766 sequence = TCCTCAAGTTAACTTGAGGT Gene: KPN_04463: Redox-sensitive transcriptional activator, MerR family |
*
Enterobacter sp. 638 Site: position = -31 score = 7.36766 sequence = TCCTCAAGTTAACTTGAGGT Gene: Ent638_0267: Redox-sensitive transcriptional activator, MerR family |
*
Erwinia amylovora ATCC 49946 Site: position = -30 score = 7.0704 sequence = TCCTCAAGTTTACTTGAGGT Gene: EAM_0317: Redox-sensitive transcriptional activator, MerR family |
|
|
|
|
|
|
Redox-sensitive transcriptional activator, MerR family |
| CRON 3. | |||||||||||||
| PF00903 |
|
|
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -59 score = 6.87237 sequence = ATCTCAAGTTAACTTGAGGT Gene: KPN_01861: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Enterobacter sp. 638 Site: position = -64 score = 6.34835 sequence = ACCTCAAGTTAACTTTAGCT Gene: Ent638_2697: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
|
|
|
|
|
|
Glyoxalase/bleomycin resistance protein/dioxygenase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |