Regulon of SoxR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_3827
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -76 Score: 7.4 Sequence: ACCTCAAGTTAACTTGAGGA Locus tag: CKO_03828 Name: soxS Funciton: Transcriptional activator of superoxide response regulon, AraC family
	CKO_03828	soxS	Transcriptional activator of superoxide response regulon, AraC family
Position: -30 Score: 7.4 Sequence: TCCTCAAGTTAACTTGAGGT Locus tag: CKO_03827 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	CKO_03827	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD