Regulon of SoxR in Erwinia amylovora ATCC 49946

Properties
Regulator type:	Transcription factor
TF locus tag:	EAM_0317
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -30 Score: 7.1 Sequence: TCCTCAAGTTTACTTGAGGT Locus tag: EAM_0317 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	EAM_0317	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -92 Score: 7.1 Sequence: ACCTCAAGTAAACTTGAGGA Locus tag: EAM_0316 Name: soxS Funciton: Transcriptional activator of superoxide response regulon, AraC family
	EAM_0316	soxS	Transcriptional activator of superoxide response regulon, AraC family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD