Regulog NikR - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - NikR
By TF family - NikR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Escherichia coli str. K-12 substr. MG1655	6	1
Salmonella typhimurium LT2	6	2
Citrobacter koseri ATCC BAA-895	6	1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	6	1
Enterobacter sp. 638	6	1
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202	11	3
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
nikA	* Escherichia coli str. K-12 substr. MG1655 Site: position = -65 score = 7.99675 sequence = GTATGACGAATACTTAAAATCGTCATAC Gene: b3476: nickel ABC transporter, periplasmic nickel-binding protein	Salmonella typhimurium LT2	* Citrobacter koseri ATCC BAA-895 Site: position = -207 score = 8.04442 sequence = GTATGATGAATCTTTAGAATCGTCATAC Gene: CKO_04926: nickel ABC transporter, periplasmic nickel-binding protein	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -52 score = 7.99675 sequence = GTATGATGAATCACTAAAATCGTCATAC Gene: KPN_03850: nickel ABC transporter, periplasmic nickel-binding protein	* Enterobacter sp. 638 Site: position = -64 score = 7.87692 sequence = GTATGATGAATTATTAGAATCGTCACAC Gene: Ent638_1834: nickel ABC transporter, periplasmic nickel-binding protein	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	* Edwardsiella tarda EIB202 Site: position = -59 score = 7.67008 sequence = GTATGCAGAATTTATAAAATCATCATAC Gene: ETAE_1379: nickel ABC transporter, periplasmic nickel-binding protein	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	nickel ABC transporter, periplasmic nickel-binding protein
nikB	Escherichia coli str. K-12 substr. MG1655 Gene: b3477: nickel transporter permease NikB	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_04927: nickel transporter permease NikB	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03851: nickel transporter permease NikB	Enterobacter sp. 638 Gene: Ent638_1835: nickel transporter permease NikB	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1378: nickel transporter permease NikB	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	nickel transporter permease NikB
nikC	Escherichia coli str. K-12 substr. MG1655 Gene: b3478: nickel transporter permease NikC	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_04928: nickel transporter permease NikC	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03852: nickel transporter permease NikC	Enterobacter sp. 638 Gene: Ent638_1836: nickel transporter permease NikC	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1377: nickel transporter permease NikC	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	nickel transporter permease NikC
nikD	Escherichia coli str. K-12 substr. MG1655 Gene: b3479: nickel transporter ATP-binding protein NikD	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_04929: nickel transporter ATP-binding protein NikD	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03853: nickel transporter ATP-binding protein NikD	Enterobacter sp. 638 Gene: Ent638_1837: nickel transporter ATP-binding protein NikD	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1376: nickel transporter ATP-binding protein NikD	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	nickel transporter ATP-binding protein NikD
nikE	Escherichia coli str. K-12 substr. MG1655 Gene: b3480: nickel transporter ATP-binding protein NikE	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_04930: nickel transporter ATP-binding protein NikE	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03854: nickel transporter ATP-binding protein NikE	Enterobacter sp. 638 Gene: Ent638_1838: nickel transporter ATP-binding protein NikE	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1375: nickel transporter ATP-binding protein NikE	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	nickel transporter ATP-binding protein NikE
nikR	Escherichia coli str. K-12 substr. MG1655 Gene: b3481: nickel responsive regulator	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895 Gene: CKO_04931: nickel responsive regulator	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03855: nickel responsive regulator	Enterobacter sp. 638 Gene: Ent638_1839: nickel responsive regulator	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_0262: nickel responsive regulator	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	nickel responsive regulator

CRON 2.
yntA	Escherichia coli str. K-12 substr. MG1655	* Salmonella typhimurium LT2 Site: position = -101 score = 6.50784 sequence = GTATGATGTTTTTAAAAGATCGTCATAC Gene: STM1255: predicted nickel ABC transporter, substrate-binding protein	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	* Edwardsiella tarda EIB202 Site: position = -171 score = 5.27379 sequence = GTATGCAGAAGTAAGGAAAAGTGCATAC Gene: ETAE_1580: predicted nickel ABC transporter, substrate-binding protein	Proteus mirabilis HI4320 Gene: PMI2516: predicted nickel ABC transporter, substrate-binding protein	Photorhabdus luminescens subsp. laumondii TTO1	predicted nickel ABC transporter, substrate-binding protein
yntB	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: STM1256: predicted nickel ABC transporter, permease protein	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1579: predicted nickel ABC transporter, permease protein	Proteus mirabilis HI4320 Gene: PMI2515: predicted nickel ABC transporter, permease protein	Photorhabdus luminescens subsp. laumondii TTO1	predicted nickel ABC transporter, permease protein
yntC	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: STM1257: predicted nickel ABC transporter, permease protein	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1578: predicted nickel ABC transporter, permease protein	Proteus mirabilis HI4320 Gene: PMI2514: predicted nickel ABC transporter, permease protein	Photorhabdus luminescens subsp. laumondii TTO1	predicted nickel ABC transporter, permease protein
yntD	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: STM1258: predicted nickel ABC transporter, ATP-binding protein	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1577: predicted nickel ABC transporter, ATP-binding protein	Proteus mirabilis HI4320 Gene: PMI2513: predicted nickel ABC transporter, ATP-binding protein	Photorhabdus luminescens subsp. laumondii TTO1	predicted nickel ABC transporter, ATP-binding protein
yntE	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: STM1259: predicted nickel ABC transporter, ATPase component	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1576: predicted nickel ABC transporter, ATPase component	Proteus mirabilis HI4320 Gene: PMI2512: predicted nickel ABC transporter, ATPase component	Photorhabdus luminescens subsp. laumondii TTO1	predicted nickel ABC transporter, ATPase component

CRON 3.
nxiA	Escherichia coli str. K-12 substr. MG1655	* Salmonella typhimurium LT2 Site: position = -79 score = 6.15122 sequence = GTGTGACGTTTTAATCAAATGATCATAC Gene: STM2783: high-affinity nickel-transporter	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03047: high-affinity nickel-transporter	Enterobacter sp. 638 Gene: Ent638_3184: high-affinity nickel-transporter	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y1245: high-affinity nickel-transporter	Serratia proteamaculans 568 Gene: Spro_2422: high-affinity nickel-transporter	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA1252: high-affinity nickel-transporter	* Edwardsiella tarda EIB202 Site: position = -120 score = 6.85813 sequence = GTATGACAATTTCATGAAAAGATCATAC Gene: ETAE_2654: high-affinity nickel-transporter	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu2170: high-affinity nickel-transporter	high-affinity nickel-transporter

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NikR - Enterobacteriales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --