Regulon of NikR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_04931
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NikR - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - NikR
By TF family - NikR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -207 Score: 8 Sequence: GTATGATGAATCTTTAGAATCGTCATAC Locus tag: CKO_04926 Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein Locus tag: CKO_04927 Name: nikB Funciton: nickel transporter permease NikB Locus tag: CKO_04928 Name: nikC Funciton: nickel transporter permease NikC Locus tag: CKO_04929 Name: nikD Funciton: nickel transporter ATP-binding protein NikD Locus tag: CKO_04930 Name: nikE Funciton: nickel transporter ATP-binding protein NikE Locus tag: CKO_04931 Name: nikR Funciton: nickel responsive regulator
	CKO_04926	nikA	nickel ABC transporter, periplasmic nickel-binding protein
	CKO_04927	nikB	nickel transporter permease NikB
	CKO_04928	nikC	nickel transporter permease NikC
	CKO_04929	nikD	nickel transporter ATP-binding protein NikD
	CKO_04930	nikE	nickel transporter ATP-binding protein NikE
	CKO_04931	nikR	nickel responsive regulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD