Regulon of NikR in Edwardsiella tarda EIB202

Properties
Regulator type:	Transcription factor
TF locus tag:	ETAE_0262
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NikR - Enterobacteriales
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - NikR
By TF family - NikR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 7.7 Sequence: GTATGCAGAATTTATAAAATCATCATAC Locus tag: ETAE_1379 Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein Locus tag: ETAE_1378 Name: nikB Funciton: nickel transporter permease NikB Locus tag: ETAE_1377 Name: nikC Funciton: nickel transporter permease NikC Locus tag: ETAE_1376 Name: nikD Funciton: nickel transporter ATP-binding protein NikD Locus tag: ETAE_1375 Name: nikE Funciton: nickel transporter ATP-binding protein NikE
	ETAE_1379	nikA	nickel ABC transporter, periplasmic nickel-binding protein
	ETAE_1378	nikB	nickel transporter permease NikB
	ETAE_1377	nikC	nickel transporter permease NikC
	ETAE_1376	nikD	nickel transporter ATP-binding protein NikD
	ETAE_1375	nikE	nickel transporter ATP-binding protein NikE
Position: -171 Score: 5.3 Sequence: GTATGCAGAAGTAAGGAAAAGTGCATAC Locus tag: ETAE_1580 Name: yntA Funciton: predicted nickel ABC transporter, substrate-binding protein Locus tag: ETAE_1579 Name: yntB Funciton: predicted nickel ABC transporter, permease protein Locus tag: ETAE_1578 Name: yntC Funciton: predicted nickel ABC transporter, permease protein Locus tag: ETAE_1577 Name: yntD Funciton: predicted nickel ABC transporter, ATP-binding protein Locus tag: ETAE_1576 Name: yntE Funciton: predicted nickel ABC transporter, ATPase component
	ETAE_1580	yntA	predicted nickel ABC transporter, substrate-binding protein
	ETAE_1579	yntB	predicted nickel ABC transporter, permease protein
	ETAE_1578	yntC	predicted nickel ABC transporter, permease protein
	ETAE_1577	yntD	predicted nickel ABC transporter, ATP-binding protein
	ETAE_1576	yntE	predicted nickel ABC transporter, ATPase component
Position: -120 Score: 6.9 Sequence: GTATGACAATTTCATGAAAAGATCATAC Locus tag: ETAE_2654 Name: nxiA Funciton: high-affinity nickel-transporter
	ETAE_2654	nxiA	high-affinity nickel-transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD