Regulon of NikR in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM3584
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NikR - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - NikR
By TF family - NikR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 6.5 Sequence: GTATGATGTTTTTAAAAGATCGTCATAC Locus tag: STM1255 Name: yntA Funciton: predicted nickel ABC transporter, substrate-binding protein Locus tag: STM1256 Name: yntB Funciton: predicted nickel ABC transporter, permease protein Locus tag: STM1257 Name: yntC Funciton: predicted nickel ABC transporter, permease protein Locus tag: STM1258 Name: yntD Funciton: predicted nickel ABC transporter, ATP-binding protein Locus tag: STM1259 Name: yntE Funciton: predicted nickel ABC transporter, ATPase component
	STM1255	yntA	predicted nickel ABC transporter, substrate-binding protein
	STM1256	yntB	predicted nickel ABC transporter, permease protein
	STM1257	yntC	predicted nickel ABC transporter, permease protein
	STM1258	yntD	predicted nickel ABC transporter, ATP-binding protein
	STM1259	yntE	predicted nickel ABC transporter, ATPase component
Position: -79 Score: 6.2 Sequence: GTGTGACGTTTTAATCAAATGATCATAC Locus tag: STM2783 Name: nxiA Funciton: high-affinity nickel-transporter
	STM2783	nxiA	high-affinity nickel-transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD