Regulog MprA - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | MarR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | 2,4-Dinitrophenol; Carbonyl cyanide m-chlorophenylhydrazone |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - MarR
- By effector - 2,4-Dinitrophenol
- By effector - Carbonyl cyanide m-chlorophenylhydrazone
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 5 | 2 |
| Salmonella typhimurium LT2 | 5 | 2 |
| Citrobacter koseri ATCC BAA-895 | 5 | 2 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 5 | 2 |
| Enterobacter sp. 638 | 5 | 2 |
| Erwinia amylovora ATCC 49946 | 5 | 2 |
| Yersinia pestis KIM | 3 | 2 |
| Serratia proteamaculans 568 | 6 | 2 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | 5 | 2 |
| Edwardsiella tarda EIB202 | 5 | 2 |
| Proteus mirabilis HI4320 | 2 | 1 |
| Photorhabdus luminescens subsp. laumondii TTO1 | 5 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| mprA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -51 score = 6.91961 sequence = ATTTGTCACTGTCGTTACTATA Gene: b2684: Transcriptional repressor mprA (EmrR protein) |
*
Salmonella typhimurium LT2 Site: position = -51 score = 6.91961 sequence = ATTTGTCACTGTCGTTACTATA Gene: STM2813: Transcriptional repressor mprA (EmrR protein) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -51 score = 6.91961 sequence = ATTTGTCACTGTCGTTACTATA Gene: CKO_04033: Transcriptional repressor mprA (EmrR protein) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -150 score = 6.18798 sequence = ATTTGTCACAATAGTTATTATA Gene: KPN_03013: Transcriptional repressor mprA (EmrR protein) |
*
Enterobacter sp. 638 Site: position = -51 score = 6.91961 sequence = ATTTGTCACTGTCGTTACTATA Gene: Ent638_3162: Transcriptional repressor mprA (EmrR protein) |
*
Erwinia amylovora ATCC 49946 Site: position = -51 score = 5.22143 sequence = ATTAATCACCATCATTATTATA Gene: EAM_2603: Transcriptional repressor mprA (EmrR protein) |
*
Yersinia pestis KIM Site: position = -26 score = 6.14797 sequence = ATTAGTAACTATCGTTACTGTA Gene: y0923: Transcriptional repressor mprA (EmrR protein) |
*
Serratia proteamaculans 568 Site: position = -50 score = 6.06398 sequence = ATTAATCACTATCGTTACTATC Gene: Spro_3741: Transcriptional repressor mprA (EmrR protein) |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -53 score = 5.37255 sequence = TTTAGTAACATTAGTTACTATG Gene: ECA3511: Transcriptional repressor mprA (EmrR protein) |
*
Edwardsiella tarda EIB202 Site: position = -51 score = 5.11508 sequence = ACTGATAACCAAAGTTACTATA Gene: ETAE_2765: Transcriptional repressor mprA (EmrR protein) |
Gene: PMI0407: Transcriptional repressor mprA (EmrR protein) |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -51 score = 4.08136 sequence = TTTGATAACAAAAGTTATCTTA Gene: plu1277: Transcriptional repressor mprA (EmrR protein) |
Transcriptional repressor mprA (EmrR protein) |
| Spro_3742 |
|
|
|
|
|
|
|
Gene: Spro_3742: RND efflux system, outer membrane lipoprotein, NodT family |
|
|
|
|
RND efflux system, outer membrane lipoprotein, NodT family |
| emrA |
Gene: b2685: multidrug resistance protein A |
Gene: STM2814: multidrug resistance protein A |
Gene: CKO_04034: multidrug resistance protein A |
Gene: KPN_03014: multidrug resistance protein A |
Gene: Ent638_3163: multidrug resistance protein A |
Gene: EAM_2604: multidrug resistance protein A |
Gene: y0922: multidrug resistance protein A |
Gene: Spro_3743: multidrug resistance protein A |
Gene: ECA3512: multidrug resistance protein A |
Gene: ETAE_2766: multidrug resistance protein A |
Gene: PMI0403: multidrug resistance protein A |
Gene: plu1276: multidrug resistance protein A |
multidrug resistance protein A |
| emrB |
Gene: b2686: multidrug resistance protein B |
Gene: STM2815: multidrug resistance protein B |
Gene: CKO_04035: multidrug resistance protein B |
Gene: KPN_03015: multidrug resistance protein B |
Gene: Ent638_3164: multidrug resistance protein B |
Gene: EAM_2605: multidrug resistance protein B |
Gene: y0921: multidrug resistance protein B |
Gene: Spro_3744: multidrug resistance protein B |
Gene: ECA3513: multidrug resistance protein B |
Gene: ETAE_2767: multidrug resistance protein B |
Gene: PMI0402: multidrug resistance protein B |
Gene: plu1275: multidrug resistance protein B |
multidrug resistance protein B |
| CRON 2. | |||||||||||||
| acrA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -106 score = 6.43495 sequence = ATTTGTGAATGTATGTACCATA Gene: b0463: acriflavin resistance protein A |
*
Salmonella typhimurium LT2 Site: position = -106 score = 5.87554 sequence = ATTTATGGATGTATGTACCATA Gene: STM0476: acriflavin resistance protein A |
*
Citrobacter koseri ATCC BAA-895 Site: position = -106 score = 6.07744 sequence = ATTTGTGGATGTATGTACCATA Gene: CKO_02688: acriflavin resistance protein A |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -107 score = 6.43495 sequence = ATTTGTGAATGTATGTACCATA Gene: KPN_00444: acriflavin resistance protein A |
*
Enterobacter sp. 638 Site: position = -107 score = 5.687 sequence = ATTTATGAATGTATGTAACATA Gene: Ent638_0943: acriflavin resistance protein A |
*
Erwinia amylovora ATCC 49946 Site: position = -98 score = 6.2662 sequence = ATTTGCGAATGTATGTACTATA Gene: EAM_1017: acriflavin resistance protein A |
*
Yersinia pestis KIM Site: position = -109 score = 5.55169 sequence = ATTCACGAATGTATGTACCATA Gene: y1050: acriflavin resistance protein A |
*
Serratia proteamaculans 568 Site: position = -107 score = 5.39608 sequence = ATTCGCGTATGTATGTACCATA Gene: Spro_1127: acriflavin resistance protein A |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -107 score = 4.47272 sequence = ATTCAAGTATGTATGTAACATA Gene: ECA1170: acriflavin resistance protein A |
*
Edwardsiella tarda EIB202 Site: position = -106 score = 5.92233 sequence = ATTGATGAATGTATGTACCATA Gene: ETAE_1011: acriflavin resistance protein A |
*
Proteus mirabilis HI4320 Site: position = -117 score = 3.84203 sequence = GATTTTGACTGAAGTTAATTTA Site: position = -90 score = 5.49624 sequence = ATTCATGTATGTTTGTACTATA Site: position = -58 score = 3.74866 sequence = ATTCATCAACTTAATTATTTTT Gene: PMI0132: acriflavin resistance protein A |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -94 score = 4.75496 sequence = ATTCACGTATGTTTGTATTATA Gene: plu3851: acriflavin resistance protein A |
acriflavin resistance protein A |
| acrB |
Gene: b0462: acriflavin resistance protein B |
Gene: STM0475: acriflavin resistance protein B |
Gene: CKO_02689: acriflavin resistance protein B |
Gene: KPN_00443: acriflavin resistance protein B |
Gene: Ent638_0942: acriflavin resistance protein B |
Gene: EAM_1016: acriflavin resistance protein B |
Gene: y1049: acriflavin resistance protein B |
Gene: Spro_1126: acriflavin resistance protein B |
Gene: ECA1169: acriflavin resistance protein B |
Gene: ETAE_1010: acriflavin resistance protein B |
Gene: PMI0131: acriflavin resistance protein B |
Gene: plu3852: acriflavin resistance protein B |
acriflavin resistance protein B |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |