Regulon of MprA in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type:	Transcription factor
TF locus tag:	ECA3511
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:	2,4-Dinitrophenol; Carbonyl cyanide m-chlorophenylhydrazone
Regulog:	MprA - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - MarR
By effector - 2,4-Dinitrophenol
By effector - Carbonyl cyanide m-chlorophenylhydrazone
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -107 Score: 4.5 Sequence: ATTCAAGTATGTATGTAACATA Locus tag: ECA1170 Name: acrA Funciton: acriflavin resistance protein A Locus tag: ECA1169 Name: acrB Funciton: acriflavin resistance protein B
	ECA1170	acrA	acriflavin resistance protein A
	ECA1169	acrB	acriflavin resistance protein B
Position: -53 Score: 5.4 Sequence: TTTAGTAACATTAGTTACTATG Locus tag: ECA3511 Name: mprA Funciton: Transcriptional repressor mprA (EmrR protein) Locus tag: ECA3512 Name: emrA Funciton: multidrug resistance protein A Locus tag: ECA3513 Name: emrB Funciton: multidrug resistance protein B
	ECA3511	mprA	Transcriptional repressor mprA (EmrR protein)
	ECA3512	emrA	multidrug resistance protein A
	ECA3513	emrB	multidrug resistance protein B

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD