Regulon of MprA in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y0923
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:	2,4-Dinitrophenol; Carbonyl cyanide m-chlorophenylhydrazone
Regulog:	MprA - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - MarR
By effector - 2,4-Dinitrophenol
By effector - Carbonyl cyanide m-chlorophenylhydrazone
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 5.6 Sequence: ATTCACGAATGTATGTACCATA Locus tag: y1050 Name: acrA Funciton: acriflavin resistance protein A Locus tag: y1049 Name: acrB Funciton: acriflavin resistance protein B
	y1050	acrA	acriflavin resistance protein A
	y1049	acrB	acriflavin resistance protein B
Position: -26 Score: 6.1 Sequence: ATTAGTAACTATCGTTACTGTA Locus tag: y0923 Name: mprA Funciton: Transcriptional repressor mprA (EmrR protein)
	y0923	mprA	Transcriptional repressor mprA (EmrR protein)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD