Regulon of MprA in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b2684
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:	2,4-Dinitrophenol; Carbonyl cyanide m-chlorophenylhydrazone
Regulog:	MprA - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - MarR
By effector - 2,4-Dinitrophenol
By effector - Carbonyl cyanide m-chlorophenylhydrazone
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 6.4 Sequence: ATTTGTGAATGTATGTACCATA Locus tag: b0463 Name: acrA Funciton: acriflavin resistance protein A Locus tag: b0462 Name: acrB Funciton: acriflavin resistance protein B
	b0463	acrA	acriflavin resistance protein A
	b0462	acrB	acriflavin resistance protein B
Position: -51 Score: 6.9 Sequence: ATTTGTCACTGTCGTTACTATA Locus tag: b2684 Name: mprA Funciton: Transcriptional repressor mprA (EmrR protein) Locus tag: b2685 Name: emrA Funciton: multidrug resistance protein A Locus tag: b2686 Name: emrB Funciton: multidrug resistance protein B
	b2684	mprA	Transcriptional repressor mprA (EmrR protein)
	b2685	emrA	multidrug resistance protein A
	b2686	emrB	multidrug resistance protein B

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD