Regulon of MprA in Proteus mirabilis HI4320

Properties
Regulator type:	Transcription factor
TF locus tag:	PMI0407
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:	2,4-Dinitrophenol; Carbonyl cyanide m-chlorophenylhydrazone
Regulog:	MprA - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - MarR
By effector - 2,4-Dinitrophenol
By effector - Carbonyl cyanide m-chlorophenylhydrazone
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 3.8 Sequence: GATTTTGACTGAAGTTAATTTA Position: -90 Score: 5.5 Sequence: ATTCATGTATGTTTGTACTATA Position: -58 Score: 3.7 Sequence: ATTCATCAACTTAATTATTTTT Locus tag: PMI0132 Name: acrA Funciton: acriflavin resistance protein A Locus tag: PMI0131 Name: acrB Funciton: acriflavin resistance protein B
	PMI0132	acrA	acriflavin resistance protein A
	PMI0131	acrB	acriflavin resistance protein B

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD