Regulog LacI - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Lactose utilization
Effector:	Allolactose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Allolactose
By pathway - Lactose utilization

Statistics of regulated genes
Genome	Genes	Operons
Escherichia coli str. K-12 substr. MG1655	3	1
Salmonella typhimurium LT2
Citrobacter koseri ATCC BAA-895	1	1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	2	1
Enterobacter sp. 638	1	1
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043	2	1
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
lacZ	* Escherichia coli str. K-12 substr. MG1655 Site: position = -38 score = 7.41669 sequence = AATTGTGAGCGGATAACAATT Gene: b0344: Beta-galactosidase (EC 3.2.1.23)	Salmonella typhimurium LT2	* Citrobacter koseri ATCC BAA-895 Site: position = -38 score = 6.99698 sequence = AATTGTGAGCGAATAACAAAC Gene: CKO_02825: Beta-galactosidase (EC 3.2.1.23)	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -37 score = 7.19071 sequence = AAATGTGAGCGGATAACAATT Gene: KPN_pKPN3p05871: Beta-galactosidase (EC 3.2.1.23)	* Enterobacter sp. 638 Site: position = -29 score = 6.31904 sequence = AATTGTGAGCGCTTCGCAAAG Gene: Ent638_0928: Beta-galactosidase (EC 3.2.1.23)	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -73 score = 7.41669 sequence = AATTGTGAGCGGATAACAATT Gene: ECA1490: Beta-galactosidase (EC 3.2.1.23)	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	Beta-galactosidase (EC 3.2.1.23)
lacY	Escherichia coli str. K-12 substr. MG1655 Gene: b0343: Lactose permease, MFS family	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_pKPN3p05870: Lactose permease, MFS family	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA1489: Lactose permease, MFS family	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	Lactose permease, MFS family
lacA	Escherichia coli str. K-12 substr. MG1655 Gene: b0342: Galactoside O-acetyltransferase (EC 2.3.1.18)	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	Galactoside O-acetyltransferase (EC 2.3.1.18)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog LacI - Enterobacteriales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --