Regulog LacI - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Lactose utilization |
| Effector: | Allolactose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - Allolactose
- By pathway - Lactose utilization
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 3 | 1 |
| Salmonella typhimurium LT2 | ||
| Citrobacter koseri ATCC BAA-895 | 1 | 1 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 2 | 1 |
| Enterobacter sp. 638 | 1 | 1 |
| Erwinia amylovora ATCC 49946 | ||
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | 2 | 1 |
| Edwardsiella tarda EIB202 | ||
| Proteus mirabilis HI4320 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| lacZ |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -38 score = 7.41669 sequence = AATTGTGAGCGGATAACAATT Gene: b0344: Beta-galactosidase (EC 3.2.1.23) |
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -38 score = 6.99698 sequence = AATTGTGAGCGAATAACAAAC Gene: CKO_02825: Beta-galactosidase (EC 3.2.1.23) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -37 score = 7.19071 sequence = AAATGTGAGCGGATAACAATT Gene: KPN_pKPN3p05871: Beta-galactosidase (EC 3.2.1.23) |
*
Enterobacter sp. 638 Site: position = -29 score = 6.31904 sequence = AATTGTGAGCGCTTCGCAAAG Gene: Ent638_0928: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -73 score = 7.41669 sequence = AATTGTGAGCGGATAACAATT Gene: ECA1490: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
Beta-galactosidase (EC 3.2.1.23) |
| lacY |
Gene: b0343: Lactose permease, MFS family |
|
|
Gene: KPN_pKPN3p05870: Lactose permease, MFS family |
|
|
|
|
Gene: ECA1489: Lactose permease, MFS family |
|
|
|
Lactose permease, MFS family |
| lacA |
Gene: b0342: Galactoside O-acetyltransferase (EC 2.3.1.18) |
|
|
|
|
|
|
|
|
|
|
|
Galactoside O-acetyltransferase (EC 2.3.1.18) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |