Regulon of LacI in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_0927
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Lactose utilization
Effector:	Allolactose
Regulog:	LacI - Enterobacteriales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Allolactose
By pathway - Lactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 6.3 Sequence: AATTGTGAGCGCTTCGCAAAG Locus tag: Ent638_0928 Name: lacZ Funciton: Beta-galactosidase (EC 3.2.1.23)
	Ent638_0928	lacZ	Beta-galactosidase (EC 3.2.1.23)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD